ORFeome > actc1 ORF1 – XORFeome v1.0

actc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: actc1
Gene ID: 865367
Gene Page ID: 480346
ORF Xenbase ID: 17263035

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099316
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 70
Ensembl gene IDs: ENSG00000159251,LRG_388
Directly associated (OMIM) disease MIM numbers: 612098,612794,613424
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,105120,108120,115200,131950,145980,182290,215600,226650,226670,607841,609285

Library Location

Plate ID: GDExl11006
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ840077
dbEST ID: 79657779
Trimmed Sequence: ATGTGTGACGACGAGGAGACTACCGCCTTGGTGTGCGACAATGGCTCCGGGCTGGTGAAGGCTGGGTTCGCTGGGGATGATGCCCCCCGTGCTGTGTTCCCCTCCATCGTTGGTCGCCCCCGTCATCAGGGTGTCATGGTGGGTATGGGTCAGAAAGACTCCTACGTAGGTGATGAAGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATTGAGCACGGTATCATCACTAACTGGGATGATATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAAGAGCACCCCACCCTGCTCACTGAGGCCCCACTGAACCCCAAGGCCAACCGTGAAAAGATGACACAGATCATGTTTGAGACCTTCAACGTCCCAGCCATGTATGTTGCCATCCAGGCTGTGCTGTCCCTGTACGCTTCTGGTCGTACCACAGGTATCGTTCTTGACTCTGGTGATGGTGTCACCCACAATGTCCCCATCTATGAAGGTTATGCTCTGCCCCATGCCATCCAGCGTCTGGACCTGGCTGGTAGAGACCTCACAGATTACCTCATGAAGATCCTGACTGAACGTGGCTACTCCTTTGTGACAACAGCTGAAAGGGAAATTGTCCGTGACATCAAGGAAAAGCTGTGCTATGTGGCTTTGGACTTTGAAAATGAAATGGCCCCCGCTGCCCTCATCCTCCCCCCTGGAAAAAGAACCTATTACCTTCCTGAACGGTCGGGTCCTTCACCATTGGAAAATTAAACGTTTC
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGACGAGGAGACTACCGCCTTGGTGTGCGACAATGGCTCCGGGCTGGTGAAGGCTGGGTTCGCTGGGGATGATGCCCCCCGTGCTGTGTTCCCCTCCATCGTTGGTCGCCCCCGTCATCAGGGTGTCATGGTGGGTATGGGTCAGAAAGACTCCTACGTAGGTGATGAAGCTCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATTGAGCACGGTATCATCACTAACTGGGATGATATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAAGAGCACCCCACCCTGCTCACTGAGGCCCCACTGAACCCCAAGGCCAACCGTGAAAAGATGACACAGATCATGTTTGAGACCTTCAACGTCCCAGCCATGTATGTTGCCATCCAGGCTGTGCTGTCCCTGTACGCTTCTGGTCGTACCACAGGTATCGTTCTTGACTCTGGTGATGGTGTCACCCACAATGTCCCCATCTATGAAGGTTATGCTCTGCCCCATGCCATCCAGCGTCTGGACCTGGCTGGTAGAGACCTCACAGATTACCTCATGAAGATCCTGACTGAACGTGGCTACTCCTTTGTGACAACAGCTGAAAGGGAAATTGTCCGTGACATCAAGGAAAAGCTGTGCTATGTGGCTTTGGACTTTGAAAATGAAATGGCCCCCGCTGCCCTCATCCTCCCCCCTGGAAAAAGAACCTATTACCTTCCTGAACGGTCGGGTCCTTCACCATTGGAAAATTAAACGTTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGACGAGGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840076
dbEST ID: 79657778
Trimmed Sequence: GAAGCACTTCCTGTGCACAATGGAGGGTCCTGCCTCATCGTATTCCTGTTTGCTGATCCACATCTGTTGGAAGGTGGACAGAGAGGCCAAGATGGAGCCACCGATCCAGACGGAGTATTTACGCTCAGGTGGGGCAATGATCTTGATCTTCATGGTGCTGGGGGCCAGGGCAGTGATCTCCTTCTGCATTCTGTCAGCAATACCAGGGTACATGGTGGTACCACCAGAGAGGACGTTGTTGGCGTACAGGTCCTTGCGGATATCAATGTCGCATTTCATGATGCTGTTGTAGGTAGTTTCATGGATACCGGCAGATTCCATACCAATGAAGGAAGGCTGGAAGAGGGTCTCAGGGCAACGGAAACGTTCATTTCCAATGGTGATGACCTGACCGTCAGGAAGCTCATAGCTCTTCTCCAGGGAGGAGGATGAGGCAGCGGTGGCCATTTCATTCTCAAAGTCCAAAGCCACATAGCACAGCTTTTCCTTGATGTCACGGACAATTTCCCTTTCAGCTGTTGTCACAAAGGAGTAACCACGTTCAATCAGGATCTTCATGAGGTAATCTGTGAGGTCTCTACCAGCCAGGTCCAGACGCTGGATGGCATGGGGGCAGAGCATAACCTTCATAAATGGGGAACTTGTGGGGTGACACCATCAACAAAATTCAAAAACAATACCTGGGGGTACAACAAAAACCGTAACGGGAAAAACACCACCCCGGGAATG
Full Trace Sequence: GGGGAAAATGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGCACTTCCTGTGCACAATGGAGGGTCCTGCCTCATCGTATTCCTGTTTGCTGATCCACATCTGTTGGAAGGTGGACAGAGAGGCCAAGATGGAGCCACCGATCCAGACGGAGTATTTACGCTCAGGTGGGGCAATGATCTTGATCTTCATGGTGCTGGGGGCCAGGGCAGTGATCTCCTTCTGCATTCTGTCAGCAATACCAGGGTACATGGTGGTACCACCAGAGAGGACGTTGTTGGCGTACAGGTCCTTGCGGATATCAATGTCGCATTTCATGATGCTGTTGTAGGTAGTTTCATGGATACCGGCAGATTCCATACCAATGAAGGAAGGCTGGAAGAGGGTCTCAGGGCAACGGAAACGTTCATTTCCAATGGTGATGACCTGACCGTCAGGAAGCTCATAGCTCTTCTCCAGGGAGGAGGATGAGGCAGCGGTGGCCATTTCATTCTCAAAGTCCAAAGCCACATAGCACAGCTTTTCCTTGATGTCACGGACAATTTCCCTTTCAGCTGTTGTCACAAAGGAGTAACCACGTTCAATCAGGATCTTCATGAGGTAATCTGTGAGGTCTCTACCAGCCAGGTCCAGACGCTGGATGGCATGGGGGCAGAGCATAACCTTCATAAATGGGGAACTTGTGGGGTGACACCATCAACAAAATTCAAAAACAATACCTGGGGGTACAACAAAAACCGTAACGGGAAAAACACCACCCCGGGAATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCACTTCCTGTGCACAA