ORFeome > actc1 ORF2 – XORFeome v1.0

actc1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: actc1
Gene ID: 865367
Gene Page ID: 480346
ORF Xenbase ID: 17263041

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041197
Original XGC clone length: 1134

Human orthology & disease relationships

NCBI Entrez ID: 70
Ensembl gene IDs: ENSG00000159251,LRG_388
Directly associated (OMIM) disease MIM numbers: 612098,612794,613424
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,105120,108120,115200,131950,145980,182290,215600,226650,226670,607841,609285

Library Location

Plate ID: GDExl11007
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ823574
dbEST ID: 79641276
Trimmed Sequence: ATGTGTGACGACGAGGAGACTACCGCCTTGGTGTGCGACAATGGCTCCGGGCTGGTGAAGGCTGGGTTCGCTGGGGATGATGCCCCACGTGCTGTGTTCCCCTCCATCGTTGGTCGCCCCCGTCATCAGGGTGTCATGGTGGGTATGGGTCAGAAAGACTCCTACGTAGGTGATGAAGCTCAAAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATTGAGCACGGTATCATCACTAACTGGGATGATATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAAGAGCACCCCACCCTGCTCACTGAGGCCCCACTGAACCCCAAGGCCAACCGTGAAAAGATGACACAGATCATGTTTGAGACCTTCAACGTCCCAGCCATGTATGTTGCCATCCAGGCTGTGCTGTCCCTGTATGCTTCTGGTCGTACCACAGGTATCGTTCTTGACTCTGGTGATGGTGTCACCCACAATGTCCCCATCTATGAAGGTTATGCTCTGCCCCATGCCATCCAGCGTCTGGACCTGGCTGGTAGAGACCTCACAGATTACCTCATGAAGATCCTGACTGAACGTGGCTACTCCTTTGTGACAACAGCTGAAAGGGAAATTGTCCGTGACATCAAGGAAAAGCTGTGCTATGTGGCTTTGGACTTTGAGAATGAAATGGCCACCGCTGCCTCATCCTCCCTCCTGGAGAAGAGCTATGAGCCTTCCCGACGGTCAGGTCATCACATTTGGAAAT
Full Trace Sequence: CCAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGACGAGGAGACTACCGCCTTGGTGTGCGACAATGGCTCCGGGCTGGTGAAGGCTGGGTTCGCTGGGGATGATGCCCCACGTGCTGTGTTCCCCTCCATCGTTGGTCGCCCCCGTCATCAGGGTGTCATGGTGGGTATGGGTCAGAAAGACTCCTACGTAGGTGATGAAGCTCAAAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATTGAGCACGGTATCATCACTAACTGGGATGATATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAAGAGCACCCCACCCTGCTCACTGAGGCCCCACTGAACCCCAAGGCCAACCGTGAAAAGATGACACAGATCATGTTTGAGACCTTCAACGTCCCAGCCATGTATGTTGCCATCCAGGCTGTGCTGTCCCTGTATGCTTCTGGTCGTACCACAGGTATCGTTCTTGACTCTGGTGATGGTGTCACCCACAATGTCCCCATCTATGAAGGTTATGCTCTGCCCCATGCCATCCAGCGTCTGGACCTGGCTGGTAGAGACCTCACAGATTACCTCATGAAGATCCTGACTGAACGTGGCTACTCCTTTGTGACAACAGCTGAAAGGGAAATTGTCCGTGACATCAAGGAAAAGCTGTGCTATGTGGCTTTGGACTTTGAGAATGAAATGGCCACCGCTGCCTCATCCTCCCTCCTGGAGAAGAGCTATGAGCCTTCCCGACGGTCAGGTCATCACATTTGGAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGTGACGACGAGGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828872
dbEST ID: 79646574
Trimmed Sequence: GAAGCACTTCCTGTGCACAATGGAGGGTCCTGCCTCATCGTATTCCTGTTTGCTGATCCACATCTGTTGGAAGGTGGACAGAGAGGCCAAGATGGAGCCACCGATCCAGACGGAGTATTTACGCTCAGGTGGGGCAATGATCTTGATCTTCATGGTGCTGGGGGCCAGGGCAGTGATCTCCTTCTGCATTCTGTCAGCAATACCAGGGTACATGGTGGTACCACCAGAGAGGACGTTGTTGGCGTACAGGTCCTTGCGGATATCAATGTCGCATTTCATGATGCTGTTGTAGGTAGTTTCATGGATACCGGCAGATTCCATACCAATGAAGGAAGGCTGGAAGAGGGTCTCAGGGCAACGGAAACGTTCATTTCCAATGGTGATGACCTGACCGTCGGGAAGCTCATAGCTCTTCTCCAGGGAGGAGGATGAGGCAGCGGTGGCCATTTCATTCTCAAAGTCCAAAGCCACATAGCACAGCTTTTCCTTGATGTCACGGACAATTTCCCTTTCAGCTGTTGTCACAAAGGAATAGCCACGTTCAGTCAGGATCTTCATGAGGTAATCTGTGAGGTCTCTACCAGCCAGGTCCAGACGCTGGATGGCATGGGGCAGAGCATAACCTTCTAAATGGGGGACATTGTGGGTGACACCCTCACCAGAAATCAAAAACGAAACCCTGTGGTTACGACCAAAAAGCATAACGGGGAACAGCCAAAG
Full Trace Sequence: TGACAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGCACTTCCTGTGCACAATGGAGGGTCCTGCCTCATCGTATTCCTGTTTGCTGATCCACATCTGTTGGAAGGTGGACAGAGAGGCCAAGATGGAGCCACCGATCCAGACGGAGTATTTACGCTCAGGTGGGGCAATGATCTTGATCTTCATGGTGCTGGGGGCCAGGGCAGTGATCTCCTTCTGCATTCTGTCAGCAATACCAGGGTACATGGTGGTACCACCAGAGAGGACGTTGTTGGCGTACAGGTCCTTGCGGATATCAATGTCGCATTTCATGATGCTGTTGTAGGTAGTTTCATGGATACCGGCAGATTCCATACCAATGAAGGAAGGCTGGAAGAGGGTCTCAGGGCAACGGAAACGTTCATTTCCAATGGTGATGACCTGACCGTCGGGAAGCTCATAGCTCTTCTCCAGGGAGGAGGATGAGGCAGCGGTGGCCATTTCATTCTCAAAGTCCAAAGCCACATAGCACAGCTTTTCCTTGATGTCACGGACAATTTCCCTTTCAGCTGTTGTCACAAAGGAATAGCCACGTTCAGTCAGGATCTTCATGAGGTAATCTGTGAGGTCTCTACCAGCCAGGTCCAGACGCTGGATGGCATGGGGCAGAGCATAACCTTCTAAATGGGGGACATTGTGGGTGACACCCTCACCAGAAATCAAAAACGAAACCCTGTGGTTACGACCAAAAAGCATAACGGGGAACAGCCAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCACTTCCTGTGCACAA