ORFeome > actr3 ORF1 – XORFeome v1.0

actr3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: actr3
Gene ID: 5915333
Gene Page ID: 5915062
ORF Xenbase ID: 17263101

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047983
Original XGC clone length: 1257

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ824178
dbEST ID: 79641880
Trimmed Sequence: ATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAACTGCCNAGGCTGTGAANGAGAAATTTAGCTACGTGTGCCCAGATTTAGGTAAGGAATTTAGCAATATGATACAGATGGTGCCAATGGATCAACAATAAAATGGGGGGTTATGGAATTTCTAAAAAGAAATTCACCACTCCAGTTGGGGCTTTAAAACCTTCCGGGGGGCCGA
Full Trace Sequence: AATGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCGGCTCCCGGCTTGTGTGGTGGATTGTGGCACCGGGTACACCAAACTTGGATATGCTGGGAATACAGAGCCACAGTTCATCATCCCATCATGTATTGCTATCAAGGAGTCAGCCAAAGTGGGAGACCAGGCTCAGAGGCGTCTTATGAAGGGGGTGGATGATCTGGACTTCCATATCGGGGATGAAGCCATAGACAAGCCAACATATGCAACTAAGTGGCCCATTCGCCATGGGATTGTCGAAGACTGGGACCTCATGGAGAGATTCATGGAACAAATTATCTTCAAATATCTCAGAGCAGAACCTGAAGATCATTACTTCCTCCTGACTGAACCCCCCTTGAATACACCAGAAAACAGGGAATACACTGCTGAAATCATGTTTGAATCTTTCAATGTTCCAGGATTGTACATTGCTGTTCAGGCTGTTCTTGCTCTGGCTGCTTCCTGGACTTCTCGACAGGTGGGAGAGCGCACACTCACTGGCACTGTCATAGACAGTGGCGATGGAGTTACTCATGTCATTCCTGTGGCTGAAGGTTATGTCATTGGCAGCTGCATTAAACACATTCCTATTGCTGGTCGGGACATAACCTATTTCATACAGCAGTTACTCCGGGATAGAGAAGTGGGAATTCCACCTGAGCAATCCCTGGAACTGCCNAGGCTGTGAANGAGAAATTTAGCTACGTGTGCCCAGATTTAGGTAAGGAATTTAGCAATATGATACAGATGGTGCCAATGGATCAACAATAAAATGGGGGGTTATGGAATTTCTAAAAAGAAATTCACCACTCCAGTTGGGGCTTTAAAACCTTCCGGGGGGCCGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCTCGGCTCCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829483
dbEST ID: 79647185
Trimmed Sequence: GGACATGACTCCAAACACGGGGTTGTGGCGACAAATGCTCGGCCCAATCTCCTCATAGTCCTTCTTGGTGTGGCACACTTGGTAAAATTCCGGCGTGGAAGCCAACATGGATCCTCCGAACCAGACAGCATACCTCTGCATGTGATGGGTAATCACCTGAACATCAATCGGCTTGGGCTTAAGACGACCACCACTCAACTCCTCGCTCAGCTTCAACCGGGCATCAACTGTTCTCTTCACATCTCTCTGCAAGCGACGTCCGAAATCCCGGAACATAGTGGACCCGCCAGAGAGTACAATATTCTTGTACAGTGGGCGCCGAACATCAATAGGGCAGTTTTGGATCACTTCATCTACCACTTCCGAGATGGGTTGGGTGAAATCTGGATTGGCAAACTCTGGATGAAAAAAGATTTCAGGCCCCAGGAAGCGTTCATAGCCAACATCGATGCTGAATTCCTTCTTAGAAACTGCATTAACCCCCATGTACTGTTTGATCCATTTGGCACCATCTGTATCATATTTGCTAAATTCCTTAACTAAATCTGGGCACACGTAGCTAAATTTCTCCTTCACAGCCTTGGCAGTTTCCAGGGATTGCTTCAGGTGAATTCCCACTTCTCTATCCCGGAAGTAACTGCTGTATGAAAAAGGGTTAAGTTCCCGACCAACCAAAAGGAAAGGTGTTTTAAGGCCACTTGCCCATGGACATAAACCCTTTCACCCCCAGGGAAAGAACAATAAATAAACTCTCCTTCGCCCC
Full Trace Sequence: CTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATANGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGACATGACTCCAAACACGGGGTTGTGGCGACAAATGCTCGGCCCAATCTCCTCATAGTCCTTCTTGGTGTGGCACACTTGGTAAAATTCCGGCGTGGAAGCCAACATGGATCCTCCGAACCAGACAGCATACCTCTGCATGTGATGGGTAATCACCTGAACATCAATCGGCTTGGGCTTAAGACGACCACCACTCAACTCCTCGCTCAGCTTCAACCGGGCATCAACTGTTCTCTTCACATCTCTCTGCAAGCGACGTCCGAAATCCCGGAACATAGTGGACCCGCCAGAGAGTACAATATTCTTGTACAGTGGGCGCCGAACATCAATAGGGCAGTTTTGGATCACTTCATCTACCACTTCCGAGATGGGTTGGGTGAAATCTGGATTGGCAAACTCTGGATGAAAAAAGATTTCAGGCCCCAGGAAGCGTTCATAGCCAACATCGATGCTGAATTCCTTCTTAGAAACTGCATTAACCCCCATGTACTGTTTGATCCATTTGGCACCATCTGTATCATATTTGCTAAATTCCTTAACTAAATCTGGGCACACGTAGCTAAATTTCTCCTTCACAGCCTTGGCAGTTTCCAGGGATTGCTTCAGGTGAATTCCCACTTCTCTATCCCGGAAGTAACTGCTGTATGAAAAAGGGTTAAGTTCCCGACCAACCAAAAGGAAAGGTGTTTTAAGGCCACTTGCCCATGGACATAAACCCTTTCACCCCCAGGGAAAGAACAATAAATAAACTCTCCTTCGCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACATGACTCCAAACAC