ORFeome > actr6 ORF1 – XORFeome v1.0

actr6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: actr6
Gene ID: 5861033
Gene Page ID: 5860963
ORF Xenbase ID: 17263107

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129725
Original XGC clone length: 1191

Human orthology & disease relationships

NCBI Entrez ID: 64431
Ensembl gene IDs: ENSG00000075089
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101400,180750,182290,600652,603278,607841

Library Location

Plate ID: GDExl11090
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ838608
dbEST ID: 79656310
Trimmed Sequence: ATGGCTACACTTGTTCTGGATAACGGGGCTTACACGGCAAAGATTGGCTACAGCCACGGACAAGTGAGTGTAATTCCTAACTGTCAGTTCAGAACCAAGACTGCACGTTTAAAAACATTTACAGCTAATCAGATTGATGAAATAAAGGATCCATCTGGCTTATTTTATATTCTTCCATTTCAAAAGGGTTATTTGGTCAACTGGGATGTCCAAAGACAAGTCTGGGACTACCTTTTTGGGAAGGAAATGTTTCAGGTGGATTTTGCGGATTGTAATATAATTATTACAGAACCTTATTTTAACTTCAGTTCTATACAAGAATCCATGAATGAAATCTTGTTTGAAGAATATCAGTTCCAAGCAGCTCTCAGAATTGATGCAGGAGCTTTGAGTGCACACAGGTATTTTCGAGATAACCCATCGGAATTGTGCTGCATCATTGTAGACAGTGGTTATTCTTTTACACATGTTGTACCGTTCTGCAGAAGTAAGAAGAAAAAAGAAGGCATTATAAGGATTAATGTCGGAGGAAAAGTAATGACAAATCATCTTAAAGAAATCATTTCATACAGGCAGCTGCAGGTTATGGATGAAACACATGTAATTAACCCAGTCAAAGAAGATGTTTGTTATGTATCTACGGATTTTTTATAAGATATGAAATTTGCAAAACTTAAAGGAGAAAAGAAATCTGTGATGGTGGACTATGGTTCTGCCTAACTTAACCACCATCAAAAAAG
Full Trace Sequence: TCGAGGCCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACACTTGTTCTGGATAACGGGGCTTACACGGCAAAGATTGGCTACAGCCACGGACAAGTGAGTGTAATTCCTAACTGTCAGTTCAGAACCAAGACTGCACGTTTAAAAACATTTACAGCTAATCAGATTGATGAAATAAAGGATCCATCTGGCTTATTTTATATTCTTCCATTTCAAAAGGGTTATTTGGTCAACTGGGATGTCCAAAGACAAGTCTGGGACTACCTTTTTGGGAAGGAAATGTTTCAGGTGGATTTTGCGGATTGTAATATAATTATTACAGAACCTTATTTTAACTTCAGTTCTATACAAGAATCCATGAATGAAATCTTGTTTGAAGAATATCAGTTCCAAGCAGCTCTCAGAATTGATGCAGGAGCTTTGAGTGCACACAGGTATTTTCGAGATAACCCATCGGAATTGTGCTGCATCATTGTAGACAGTGGTTATTCTTTTACACATGTTGTACCGTTCTGCAGAAGTAAGAAGAAAAAAGAAGGCATTATAAGGATTAATGTCGGAGGAAAAGTAATGACAAATCATCTTAAAGAAATCATTTCATACAGGCAGCTGCAGGTTATGGATGAAACACATGTAATTAACCCAGTCAAAGAAGATGTTTGTTATGTATCTACGGATTTTTTATAAGATATGAAATTTGCAAAACTTAAAGGAGAAAAGAAATCTGTGATGGTGGACTATGGTTCTGCCTAACTTAACCACCATCAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACACTTGTTCTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ838607
dbEST ID: 79656309
Trimmed Sequence: AATGTCAAACTTTTCTTCACAAATAGCATGGCCATTTTCCTCATAGTCTTCCCTGGTTACCACCATGTCTTCAAAATCATCATTTTCAGATATGATCTTTCCTCCTTCCCAGGAATAAGAGATGGGATTTTCAGGTAATATGACAGACACATCAAAGTCTGTAGGCGTGAGCTTCCGGACCTCAGAAAATACCCGTTCCCTGAAACCAGGGAATAGTGTGTTTCCACCAGTGAGAACAATGTTCTTGTAGAAATGAGGTTGCATCTCTTCTGGAAGATTATTAATGGAATGCACAATGGCTTCTGGAATTCCCATTTCTTGAATCCCAATGTCCGAGGGATGGAAAAGTATCTCAGGGACAGCAAATCTCTCATTGGTCAAACGTAGTATTTGCTCCCCAGCTGTGGTCTTTCCGCTAAACACCATCTCTTCTCTTGGCTTGCAAAACCCTTTTTTGATGGTGCTAAAGTCAGGCAGAACATAGTCCACCATCACAGAGTTCTCTTCTCCTTTAAGTTTTGCAATTTCCATATCTTTATAAAAATCCGTAGATACATAACAAACATCTTCTTTGACTTGGTTAGTTACATGTGTTTCATCCATAACCTGCAGCTGCCTGTATGAGATGATTTTCTTTAAGATGATTTGTCATTACTTTTCCTCCGACATTAATCCTATAATGCCCCTCTTTTTTCTTTCTTACTTCTGCAAAACGGTTACAACATGTTGTAAAAAAATAAACCCACTGTTCATACAATGAATGCAGCCCAAAATTTCCCAAAG
Full Trace Sequence: GGGAAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATGTCAAACTTTTCTTCACAAATAGCATGGCCATTTTCCTCATAGTCTTCCCTGGTTACCACCATGTCTTCAAAATCATCATTTTCAGATATGATCTTTCCTCCTTCCCAGGAATAAGAGATGGGATTTTCAGGTAATATGACAGACACATCAAAGTCTGTAGGCGTGAGCTTCCGGACCTCAGAAAATACCCGTTCCCTGAAACCAGGGAATAGTGTGTTTCCACCAGTGAGAACAATGTTCTTGTAGAAATGAGGTTGCATCTCTTCTGGAAGATTATTAATGGAATGCACAATGGCTTCTGGAATTCCCATTTCTTGAATCCCAATGTCCGAGGGATGGAAAAGTATCTCAGGGACAGCAAATCTCTCATTGGTCAAACGTAGTATTTGCTCCCCAGCTGTGGTCTTTCCGCTAAACACCATCTCTTCTCTTGGCTTGCAAAACCCTTTTTTGATGGTGCTAAAGTCAGGCAGAACATAGTCCACCATCACAGAGTTCTCTTCTCCTTTAAGTTTTGCAATTTCCATATCTTTATAAAAATCCGTAGATACATAACAAACATCTTCTTTGACTTGGTTAGTTACATGTGTTTCATCCATAACCTGCAGCTGCCTGTATGAGATGATTTTCTTTAAGATGATTTGTCATTACTTTTCCTCCGACATTAATCCTATAATGCCCCTCTTTTTTCTTTCTTACTTCTGCAAAACGGTTACAACATGTTGTAAAAAAATAAACCCACTGTTCATACAATGAATGCAGCCCAAAATTTCCCAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATGTCAAACTTTTCTTCACAA