ORFeome > adck3 ORF1 – XORFeome v1.0

adck3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: adck3
Gene ID: 946120
Gene Page ID: 946115
ORF Xenbase ID: 17263227

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133200
Original XGC clone length: 1932

Human orthology & disease relationships

NCBI Entrez ID: 56997
Ensembl gene IDs: ENSG00000163050
Directly associated (OMIM) disease MIM numbers: 612016
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ838560
dbEST ID: 79656262
Trimmed Sequence: ATGGCGGGGGATGCACTAATGCAGATGAGACGCCTGGCCAATCTCATCAAGGCTGTATTACAGGTGCAGGCCGGGCAACTGCGCCAGCCAACACTTGGCATAAATGGCATTGGATTTGCCAGGAGCTGGCAGGTGGCGGTGGAGGAACGTTTCAGTGCTGCAATGGGAAAGATGCAGGATCTGGGCAAGCAGCAAGAGAACCTTGCTGAGCAGGAAATTGACACAAAAAACAGCTTCTCTGGGCCGGCTTCAGAGATTGCTGGCATGGACCATTCCCCGTCTTCCAGCCAGACTCAGGAATTGCACCACAGTGAGGCTGATGCACCGAGCAAGGATACAACTTACAGGGGTCAGCCGCAAACAGACCGCTCTTTCCATCCTGACCTGTCTGTTGAAAGGGACAATGGGGCCTTGTTTGGAAACGTCCATGACAGTACCAGCCCTTTTGCAGCATACGGCCAAAAAGAACTTTTCACCAGGACCATTCCTCTGTTTAGTGGGCTCACAGCTTGAGATATTTGATAAGGCCAGATATACCAAAATAAAACCAAACCACAGACCTCATAAACAAATGCTCAAGGATCGAGCCCTAAAAAAAAATATAGCCATCTCGCCCATTGGTAAGGTTTTCAATTTTTGAGGTCTTGGCTTTAAAGATAGGTATCCGTGCCAATGTGAAGATAAAAAAATATAAACTATATCCCAAACCATATAACTATATAAAGTAATATATTCAAGATTATTATTCACTCTGTTCTCTTATGTATATTATATTTTGTTATTATAACTTTCGGTTTGTGATATTTATAGTAATTT
Full Trace Sequence: GGGGCTCATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCNCNNATTGATGANCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGGATGCACTAATGCAGATGAGACGCCTGGCCAATCTCATCAAGGCTGTATTACAGGTGCAGGCCGGGCAACTGCGCCAGCCAACACTTGGCATAAATGGCATTGGATTTGCCAGGAGCTGGCAGGTGGCGGTGGAGGAACGTTTCAGTGCTGCAATGGGAAAGATGCAGGATCTGGGCAAGCAGCAAGAGAACCTTGCTGAGCAGGAAATTGACACAAAAAACAGCTTCTCTGGGCCGGCTTCAGAGATTGCTGGCATGGACCATTCCCCGTCTTCCAGCCAGACTCAGGAATTGCACCACAGTGAGGCTGATGCACCGAGCAAGGATACAACTTACAGGGGTCAGCCGCAAACAGACCGCTCTTTCCATCCTGACCTGTCTGTTGAAAGGGACAATGGGGCCTTGTTTGGAAACGTCCATGACAGTACCAGCCCTTTTGCAGCATACGGCCAAAAAGAACTTTTCACCAGGACCATTCCTCTGTTTAGTGGGCTCACAGCTTGAGATATTTGATAAGGCCAGATATACCAAAATAAAACCAAACCACAGACCTCATAAACAAATGCTCAAGGATCGAGCCCTAAAAAAAAATATAGCCATCTCGCCCATTGGTAAGGTTTTCAATTTTTGAGGTCTTGGCTTTAAAGATAGGTATCCGTGCCAATGTGAAGATAAAAAAATATAAACTATATCCCAAACCATATAACTATATAAAGTAATATATTCAAGATTATTATTCACTCTGTTCTCTTATGTATATTATATTTTGTTATTATAACTTTCGGTTTGTGATATTTATAGTAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGGATGCACT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTNCNNCTTTTTNATNANCAATGCTTTCTTATAATNCCAACTTTNTACAAAAAANTTNNCAATTTNCTTTTTCTCTTCCANTTCATCCCCCACCCTTTATTTAATTTTTTCATCCTCTACTTTAACTACATAAAATCCTCNCTCTCCCTCACCCTCTCCAAAAACTTCTCCATCANTCAATTAAAAATAAATACTTCTTATACACACATCATCTCCCCCATCTTCTTACCACAATCCACAACAAAACAAAAANTCANTACAATCCTTTCANCATTTTCTTCCNTCANTAAAAANCTCAAATCCATAACAAACTTCTTACCTAANCCATTNTCTATTTTTANNTTTAANCTTTTCATTNCAACCTCCCCCNAANCCCCNATACCCNNNCCTACNNCCAANCCTCCNACAAANACCAANCNTNCAACCNCCNNTNANTNANNACTTNNNTCNNNAANNNNNTCNNNNANCNATNNNTTNTNANNNNTANNNNNNNNNAAANNNNTNNANTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNAANNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNAANNNNNNNNNNANNAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGCTTTTTCTCTTCCAGT