ORFeome > adhfe1 ORF1 – XORFeome v1.0

adhfe1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: adhfe1
Gene ID: 966434
Gene Page ID: 966428
ORF Xenbase ID: 17263269

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124888
Original XGC clone length: 1392

Human orthology & disease relationships

NCBI Entrez ID: 137872
Ensembl gene IDs: ENSG00000147576
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 140350,200950,203500,241500,241510,264600,270200,276710,300000,307030,608643

Library Location

Plate ID: GDExl11088
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ838204
dbEST ID: 79655906
Trimmed Sequence: ATGGCTGCCGGACGCGATGGAGTGATCCATTTATTGAGACAACTGCAGCGAGCATCATGCAGGTGTCCGGCTCATTCTCACACTTATTCTCAAGCTCCAGCTACTGCAAGAACAACAGACTATGCATTTGAGATGGCAGTCTCAAGCATTCGATATGGAGAAAATGTTACCCAGGAAATTGGCATGGACTTGCAGAATTGGGGAACCAGGAATGTCTGTGTGATGACTGATAGGAACCTTTCAGAGCTCTCCCCTGTAAAGGCTGTATTAAATTCACTAGTAAAGAATGGCATCAACTTCAAATTATATGACAGTGTTCGGGTGGAACCAACCGATAAAAGCTTTATGGATGCTATTGAGTTTGCTAAGAAAGGACAGTTTGATGCCTTTGTTGCTGTTGGAGGAGGTTCTGTAATTGACACATGCAAAGCTGCCAACTTGTATTCTTCCAGCCCTGATTCTGATTTCCTGGATTATGTCAACCCTCCAATAGGGAAAGGCAAAGCAGTGACTGTGCCTCTTAAACCACTTATTGCAGTCCCAACCACATCTGGAACCGGAAGCGAGACAACAGGAATTGCTATATTCGACTATGAAAAACTAAAAGCCAAAACAGGTATTGCATCTAGAGCTATTAAGCCCACTTTAGGTTTGATTGACCCAGCACACACCCTTTCTATGCCTTAAAAAGTAATTGGCAAAAACCGGTTTTGAATGTATTGTGCAATTCCCTTTGGATCCTAACCTGGCCCTTCCCTATTAACATTGCCCAACCCCCGGGGTGAACCAGACCCCCTTTTACACCTTCCAACCTTTATTCG
Full Trace Sequence: TCGAGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCGGACGCGATGGAGTGATCCATTTATTGAGACAACTGCAGCGAGCATCATGCAGGTGTCCGGCTCATTCTCACACTTATTCTCAAGCTCCAGCTACTGCAAGAACAACAGACTATGCATTTGAGATGGCAGTCTCAAGCATTCGATATGGAGAAAATGTTACCCAGGAAATTGGCATGGACTTGCAGAATTGGGGAACCAGGAATGTCTGTGTGATGACTGATAGGAACCTTTCAGAGCTCTCCCCTGTAAAGGCTGTATTAAATTCACTAGTAAAGAATGGCATCAACTTCAAATTATATGACAGTGTTCGGGTGGAACCAACCGATAAAAGCTTTATGGATGCTATTGAGTTTGCTAAGAAAGGACAGTTTGATGCCTTTGTTGCTGTTGGAGGAGGTTCTGTAATTGACACATGCAAAGCTGCCAACTTGTATTCTTCCAGCCCTGATTCTGATTTCCTGGATTATGTCAACCCTCCAATAGGGAAAGGCAAAGCAGTGACTGTGCCTCTTAAACCACTTATTGCAGTCCCAACCACATCTGGAACCGGAAGCGAGACAACAGGAATTGCTATATTCGACTATGAAAAACTAAAAGCCAAAACAGGTATTGCATCTAGAGCTATTAAGCCCACTTTAGGTTTGATTGACCCAGCACACACCCTTTCTATGCCTTAAAAAGTAATTGGCAAAAACCGGTTTTGAATGTATTGTGCAATTCCCTTTGGATCCTAACCTGGCCCTTCCCTATTAACATTGCCCAACCCCCGGGGTGAACCAGACCCCCTTTTACACCTTCCAACCTTTATTCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCCGGACGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838203
dbEST ID: 79655905
Trimmed Sequence: ATAAAGTTTCATTGAAGCCTCAAACAACGCAGCTAGTTCCTCTTCAGAATGTGCTCGAGGAGACAGCTTTGTTACTCGTTCCTGGGGCAAAGTTCCTTTCACCAAGGCCGGTATATCCTCAGCAGTATATCCTACAGCTGCCAAACCATCATCAACATTCAGGTCATACAGAAATTTCCGTAGCGTGTCTGCCAGGATAAGCCCAGCATCTTTGATTTTGGCAGTCCGGAGGTCAGCTCCCAGAATTTCTGCTGCCTCCAGGTGTCGCTCAGGACACATTAATCCTGTGAATGAAAATACTGCCGGAGATGTGAGAACAACAGAAAGGCCATGGGGCACTAATGGATGATCCACTTTGTAATCTTTGGCTCTGTAAGTCTTCACATGTCCTGCAATAGGGTACGACATTCCGTGGCAAAGATGTACCCCAGCATTTCCAAAGCCTACTCCTGCAAATGAACTTGCCAAGTGCATGGCGAACCGAGCTTCACGGTCATCGGGATTCCTTACGGCTCTCTTTAAAAACTTGGCTACGATCCTCAAGGCGTGTTTAGCCCAAACATCACTAATAGGGTTGCTCCCCTGATAAGCTGGACGGTTAATTGGGTTGGTAAGACAGGGGCTGCGCATGTTTAATGGAAGGGGCATGGTAGAATTCAGGGAATGGGACAATACATTAAAAACCGCTTTTTTGCCACTTCTCTTTTCGGGCATAAAAAAGTTGGGGGGTGCCGGGGGTCCAACCAAAACCCTAAAGGGGGGGCC
Full Trace Sequence: GGGAAATATGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAAAGTTTCATTGAAGCCTCAAACAACGCAGCTAGTTCCTCTTCAGAATGTGCTCGAGGAGACAGCTTTGTTACTCGTTCCTGGGGCAAAGTTCCTTTCACCAAGGCCGGTATATCCTCAGCAGTATATCCTACAGCTGCCAAACCATCATCAACATTCAGGTCATACAGAAATTTCCGTAGCGTGTCTGCCAGGATAAGCCCAGCATCTTTGATTTTGGCAGTCCGGAGGTCAGCTCCCAGAATTTCTGCTGCCTCCAGGTGTCGCTCAGGACACATTAATCCTGTGAATGAAAATACTGCCGGAGATGTGAGAACAACAGAAAGGCCATGGGGCACTAATGGATGATCCACTTTGTAATCTTTGGCTCTGTAAGTCTTCACATGTCCTGCAATAGGGTACGACATTCCGTGGCAAAGATGTACCCCAGCATTTCCAAAGCCTACTCCTGCAAATGAACTTGCCAAGTGCATGGCGAACCGAGCTTCACGGTCATCGGGATTCCTTACGGCTCTCTTTAAAAACTTGGCTACGATCCTCAAGGCGTGTTTAGCCCAAACATCACTAATAGGGTTGCTCCCCTGATAAGCTGGACGGTTAATTGGGTTGGTAAGACAGGGGCTGCGCATGTTTAATGGAAGGGGCATGGTAGAATTCAGGGAATGGGACAATACATTAAAAACCGCTTTTTTGCCACTTCTCTTTTCGGGCATAAAAAAGTTGGGGGGTGCCGGGGGTCCAACCAAAACCCTAAAGGGGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAAGTTTCATTGAAGCCTC