ORFeome > adrm1 ORF2 – XORFeome v1.0

adrm1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: adrm1
Gene ID: 6252580
Gene Page ID: 489444
ORF Xenbase ID: 17263359

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC073651
Original XGC clone length: 1215

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ838489
dbEST ID: 79656191
Trimmed Sequence: ATGTCGTCTGGAGCGCTGTTTCCCAGTTTGGTCCCTGGCTCTCGGGGTTCTTCGAGCAAATATCTAGTGGAGTTTCGAGCAGGCAAAATGTCCCTAAAGGGCAGCACGGTGACACCAGACAAAAGGAAAGGTCTCGTTTACATCCAGCAAACAGACGACTCTCTCATTCACTTTTGCTGGAAGGATAGAACATCTGGCAGCGTGGAGGATGATCTGATCATCTTTCCAGATGACTGTGAGTTTAAGAGAGTGTCACAGTGCACCACAGGGCGTGTGTATGTTCTCAAGTTCAAGGCTGGCTCCAAGAGGCTCTTTTTCTGGATGCAGGAACCCAAGACTGATAAAGATGAGGAGTATTGCAGAAAGCTTAATGAATATCTAAATAACCCACCCATGCCTGGCGCCCTTGGGGGAAGTGGCAGCGGTAGCCATGAGCTCTCTGCTTTGGGAGGAGAAGGTGGACTGCAAAGCCTGCTGGGAAACATGAGCCATAACCAGCTCATGCAGCTCATTGGACCCACTGGACTCGGAGGACTTGGTGGGCTTGGAGCTTTAACTGGACCCGGACTGGCCAGTCTGTTGGGTAGTGGAGGACCCACAACAAGCAGTTCTTCTTCCAGTTCTCGCAGTCAGTCGGCAGCTGTCACTCCATCATCTACAACCTCATCAAAACGGAACAACGTCGGCCCCGGTCGCTTCAGCTGGCATCTCCGTGCACAAACCCCAAGCCAACCTGTTCACCTTCAACAAATGGGGCCCAGGGGAGCAAAGTAGCCCCCACCCAACCCAATTTTCCCCTTAAATTAACCCTTCAA
Full Trace Sequence: CGGGGGCCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGTCTGGAGCGCTGTTTCCCAGTTTGGTCCCTGGCTCTCGGGGTTCTTCGAGCAAATATCTAGTGGAGTTTCGAGCAGGCAAAATGTCCCTAAAGGGCAGCACGGTGACACCAGACAAAAGGAAAGGTCTCGTTTACATCCAGCAAACAGACGACTCTCTCATTCACTTTTGCTGGAAGGATAGAACATCTGGCAGCGTGGAGGATGATCTGATCATCTTTCCAGATGACTGTGAGTTTAAGAGAGTGTCACAGTGCACCACAGGGCGTGTGTATGTTCTCAAGTTCAAGGCTGGCTCCAAGAGGCTCTTTTTCTGGATGCAGGAACCCAAGACTGATAAAGATGAGGAGTATTGCAGAAAGCTTAATGAATATCTAAATAACCCACCCATGCCTGGCGCCCTTGGGGGAAGTGGCAGCGGTAGCCATGAGCTCTCTGCTTTGGGAGGAGAAGGTGGACTGCAAAGCCTGCTGGGAAACATGAGCCATAACCAGCTCATGCAGCTCATTGGACCCACTGGACTCGGAGGACTTGGTGGGCTTGGAGCTTTAACTGGACCCGGACTGGCCAGTCTGTTGGGTAGTGGAGGACCCACAACAAGCAGTTCTTCTTCCAGTTCTCGCAGTCAGTCGGCAGCTGTCACTCCATCATCTACAACCTCATCAAAACGGAACAACGTCGGCCCCGGTCGCTTCAGCTGGCATCTCCGTGCACAAACCCCAAGCCAACCTGTTCACCTTCAACAAATGGGGCCCAGGGGAGCAAAGTAGCCCCCACCCAACCCAATTTTCCCCTTAAATTAACCCTTCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTCTGGAGCGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838488
dbEST ID: 79656190
Trimmed Sequence: ATCTAAGCTCATATCCTCCTCCTCCTCTTTCTTCTCACTGGACTCTCGCTCCTTTTGGGAGGAAGTGCTCTGCATCGCTTTGGCGAAGGCTTCAATATCTCCTTTATTCGCTGCATCCACCGCATCCGCAGGCAGGCCAAACTGACTCATCAGGGGTCCCAACTGTCCAGATGCAAGAGCCGCACTAAACATACCCAGAGCCTGCTGAAACTGCGGGGAGGTTAAAGTGTTCTGGATCTCATCTGCCGTCTGAGGAAGGGATTCTCCTGATGGAAGGTAAGGTGTCAGTCTCTCCTGGACCTCCGCATTAGCCAGGATTGGAGCCATAATCTCTGGGGTGAGAACGCTGGCAAGATCCACTTGCTGTCCTCCTTCCCCTGTGGCAGGGACATTCATTGTGGCCAAGATGTTCTGCAGGTCACTCAGCTGAATTGGTTGAGTGGGGCTAGTTGCTTCACTGGCCCCATCGTTGGAGCTGACAGCTGGGCTTGGGGTTGTGGCAGGAGCTGCAGCTGGAGCGACAGGGGCAGACGTTGTCCGTGTTGATGAGGTTTTAAATGATGGAGTGACAGCTGCCGACTGACTGCGAGAACTGGAAAGAGAACTGCCTTGTTGTGGGTCCTCCACTAACCAACAAAATGGCCAGTCCCGGTCCAGTTTAAAGTCCCAGCCCACCAACTCCTCCAAAATCATTGGGGTCAAATAAACCTGGAGGAAACTGGTTAATGGCTCAAGTTTTTCCCAAACCGGGGTTTTTGGTATTCCCC
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTAAGCTCATATCCTCCTCCTCCTCTTTCTTCTCACTGGACTCTCGCTCCTTTTGGGAGGAAGTGCTCTGCATCGCTTTGGCGAAGGCTTCAATATCTCCTTTATTCGCTGCATCCACCGCATCCGCAGGCAGGCCAAACTGACTCATCAGGGGTCCCAACTGTCCAGATGCAAGAGCCGCACTAAACATACCCAGAGCCTGCTGAAACTGCGGGGAGGTTAAAGTGTTCTGGATCTCATCTGCCGTCTGAGGAAGGGATTCTCCTGATGGAAGGTAAGGTGTCAGTCTCTCCTGGACCTCCGCATTAGCCAGGATTGGAGCCATAATCTCTGGGGTGAGAACGCTGGCAAGATCCACTTGCTGTCCTCCTTCCCCTGTGGCAGGGACATTCATTGTGGCCAAGATGTTCTGCAGGTCACTCAGCTGAATTGGTTGAGTGGGGCTAGTTGCTTCACTGGCCCCATCGTTGGAGCTGACAGCTGGGCTTGGGGTTGTGGCAGGAGCTGCAGCTGGAGCGACAGGGGCAGACGTTGTCCGTGTTGATGAGGTTTTAAATGATGGAGTGACAGCTGCCGACTGACTGCGAGAACTGGAAAGAGAACTGCCTTGTTGTGGGTCCTCCACTAACCAACAAAATGGCCAGTCCCGGTCCAGTTTAAAGTCCCAGCCCACCAACTCCTCCAAAATCATTGGGGTCAAATAAACCTGGAGGAAACTGGTTAATGGCTCAAGTTTTTCCCAAACCGGGGTTTTTGGTATTCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTAAGCTCATATCCTCCTC