ORFeome > agpat6 ORF2 – XORFeome v1.0

agpat6 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: agpat6
Gene ID: 5967274
Gene Page ID: 999685
ORF Xenbase ID: 17263515

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123183
Original XGC clone length: 1362

Human orthology & disease relationships

NCBI Entrez ID: 137964
Ensembl gene IDs: ENSG00000158669
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 211980,607785,608594

Library Location

Plate ID: GDExl11088
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ838106
dbEST ID: 79655808
Trimmed Sequence: ATGAGCTCCCTGCTCCCATTTGATAGTGTTCTATGCCTCCTCCTGAGGCTCTCCCTCACTCTGTGGTTCACACTTCTGCTGGTGTTCATCATCGTGCCTGCTATATTTGGTGTATCGTTTGGAATTCGCAGGCTCTATATGAAGACGCTGCTTCGTATTTTCACGTGGGCGACCTTGCGTATTGAGAGAGGAATAAAGGAGAAAAGCCACACTCTCTATAAACCTCTTAGTAATGGGATTATTGCTAAGGAGAGCACTTCCCTTGAGGAAGGAATCTGGGAGCTTCGAAGCAATGGGCGCTCTTTGGACAGGCCAGAGTTTGAATTGTCGGACATCTTTTACTTCTGTCGACAGGGCATGGAGAGCATCATGGACGATGAGGTGACGCAACGTTTTTCAGCCGAGGAGCTGGAGACATGGAACCTACTTACTAGGACCAACTACAACTTTCAGCACATCAGTGTCCAGCTCACCGTACTCTGGGGACTGGGCATGCTGGTGCGCTACACCTTTTTACTACCCCTTAGAGTTGCTCTCGCTATTACAGGGGTCAGCCTTCTGGTTATCGGTACTACTGGTAGTGGGGTTGCTGCCAAATGGAAAGTTTAAGAAGTTTCTGAGTAAACATGTTCATCTGATGTGTTACCAGAACTGTGTGCGTGCTCTTACGGCTATTTTACGTATCCATGAAATTGAAATTGGGCCAGGAAATGGCGCCTCCTGGTGGTGGAACAAACATTTCCATCAAAGTTACCTTTCGTGCTTGTGA
Full Trace Sequence: TGCCCCCTATAATGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCTCCCTGCTCCCATTTGATAGTGTTCTATGCCTCCTCCTGAGGCTCTCCCTCACTCTGTGGTTCACACTTCTGCTGGTGTTCATCATCGTGCCTGCTATATTTGGTGTATCGTTTGGAATTCGCAGGCTCTATATGAAGACGCTGCTTCGTATTTTCACGTGGGCGACCTTGCGTATTGAGAGAGGAATAAAGGAGAAAAGCCACACTCTCTATAAACCTCTTAGTAATGGGATTATTGCTAAGGAGAGCACTTCCCTTGAGGAAGGAATCTGGGAGCTTCGAAGCAATGGGCGCTCTTTGGACAGGCCAGAGTTTGAATTGTCGGACATCTTTTACTTCTGTCGACAGGGCATGGAGAGCATCATGGACGATGAGGTGACGCAACGTTTTTCAGCCGAGGAGCTGGAGACATGGAACCTACTTACTAGGACCAACTACAACTTTCAGCACATCAGTGTCCAGCTCACCGTACTCTGGGGACTGGGCATGCTGGTGCGCTACACCTTTTTACTACCCCTTAGAGTTGCTCTCGCTATTACAGGGGTCAGCCTTCTGGTTATCGGTACTACTGGTAGTGGGGTTGCTGCCAAATGGAAAGTTTAAGAAGTTTCTGAGTAAACATGTTCATCTGATGTGTTACCAGAACTGTGTGCGTGCTCTTACGGCTATTTTACGTATCCATGAAATTGAAATTGGGCCAGGAAATGGCGCCTCCTGGTGGTGGAACAAACATTTCCATCAAAGTTACCTTTCGTGCTTGTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTCCCTGCTCCCATT

Sequences - 3ʹ (reverse) EST

Accession: JZ838105
dbEST ID: 79655807
Trimmed Sequence: GGATCGGCTGCGATTTTCCTGACTCCCAGCAATGATTCGGCTGTACACCTTCTGCTGCTCTTCTTTGTATGCGTCTTTCACCTTCTCACGTTTCAGTCCCCCATCCCATAGCAAATCAACAAGTCCTCCTTGGTGTGCAATGGCTGACTTCACTCGGTTAGCAAACTGCACAGCATCCTCATTCTCCTGGCGAGTCATGGGAGGCAGGTACCAAACACTACATACTATGGCCCAGCTAGTCATCATTCGTAGCAGGTAAGTTACCATCCCATTTTTACTGCTGTTCCAAAAGGCATCACCAAAACGGGGGTCATACTTTATAGCTACTGGATACACCGTGGCTCCTATTTCAAAACTGCCTTTTTTGAACATCATAACTGAAGTATTGTTGATGCAAGTACCTTCGGGAAATATAAGAATAGGCAACTTGCTCTTGTCTTGCACATGATCCGTAAGCCTTTTAGCGACAAGGTGTCTGTCCTTCACCTCAGAGCGCTCAAACCAGACATGTGGACATGACTTCACCATGGCTCTTTGGATTACTCCCATCAAACCCCCGTGAACCTGGCCGACCATAGCATAGTATCCATCACTAGCTAGAATGATCACATCNGATTGGAGATGTATGATTGGCCACACAGATGCCCCCATTCCTGGGCCGAATCTCACTTCCATGATAAGTTTATAATAGCAGTAAAAACCACGCCCCACGAATCGGGGTAACACCATCCAAATAAAACATGGCTTAACTCAAAAAAACCCCTTAAAACCT
Full Trace Sequence: CGGGAAAATGCTATGGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATCGGCTGCGATTTTCCTGACTCCCAGCAATGATTCGGCTGTACACCTTCTGCTGCTCTTCTTTGTATGCGTCTTTCACCTTCTCACGTTTCAGTCCCCCATCCCATAGCAAATCAACAAGTCCTCCTTGGTGTGCAATGGCTGACTTCACTCGGTTAGCAAACTGCACAGCATCCTCATTCTCCTGGCGAGTCATGGGAGGCAGGTACCAAACACTACATACTATGGCCCAGCTAGTCATCATTCGTAGCAGGTAAGTTACCATCCCATTTTTACTGCTGTTCCAAAAGGCATCACCAAAACGGGGGTCATACTTTATAGCTACTGGATACACCGTGGCTCCTATTTCAAAACTGCCTTTTTTGAACATCATAACTGAAGTATTGTTGATGCAAGTACCTTCGGGAAATATAAGAATAGGCAACTTGCTCTTGTCTTGCACATGATCCGTAAGCCTTTTAGCGACAAGGTGTCTGTCCTTCACCTCAGAGCGCTCAAACCAGACATGTGGACATGACTTCACCATGGCTCTTTGGATTACTCCCATCAAACCCCCGTGAACCTGGCCGACCATAGCATAGTATCCATCACTAGCTAGAATGATCACATCNGATTGGAGATGTATGATTGGCCACACAGATGCCCCCATTCCTGGGCCGAATCTCACTTCCATGATAAGTTTATAATAGCAGTAAAAACCACGCCCCACGAATCGGGGTAACACCATCCAAATAAAACATGGCTTAACTCAAAAAAACCCCTTAAAACCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATCGGCTGCGATTTTCCT