ORFeome > aida ORF1 – XORFeome v1.0

aida ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aida
Gene ID: 6255156
Gene Page ID: 5822442
ORF Xenbase ID: 17263599

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC059964
Original XGC clone length: 918

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11018
Well Location: E02

Sequences - 5ʹ (forward) EST

Accession: JZ824452
dbEST ID: 79642154
Trimmed Sequence: ATGAGTGACATGAACAAGATCCTGCAGAAATGGGGCGCCAGCCTGAGGAAGGGAACTGACTTTGACTCGTGGGGGCAACTGGTGGAGGCCATTGATGAGTATCAGATATTAGCAAGGCAGCTCCAGAAAGAAGCCCAGTCTCCAGCCAACTCCTCTGACTTTACGGAAGATCAGAAGAAAACCATTGGAAAGATCGCAACATGCCTGGAACTCCGCAGCGCTGCCCTACAGTACACGCAGTCCCAGGAGGGCTTCACGCTGGAGGATGTAAAGAAACTGGAACCAATTTTAAGCTCCATTCTCACCTTCAACAAAGAATTCCCCTTTGATGTACAGCCTGTTCCGTTAAGGAGGATTTTAGCGCCTGGGGAAGAGGAGAATTTAGAAGTAGAAGAAGAGGAAGAAGATGGCGGGGCCGGAGCTGGGTCTCCTGATTTGTTTCCTGCCCGTGTTCCAGGTACGCTCTTACCCAGACTGCCATCTGAACCCGGAATGACGTTACTAACAATTAAAATTGAGAAGATTGGCTTGAAAGATGCGGGACAGTGTATTGATCCTTACATTACTGTTAGTGTAAAGGATTTAAATGGAATCGACTTGACTCCAGTACAAGACACCCCCATGGCCGTGAGGAAAGAAGATACTTATGTCCATTTTAATGTTGAAATTGAAATCCAGAAACACGTGGAAAAACTTACAAAAGGGGCAGCTATTTTCTTTGAATTTCAGCACTACNAACCGAAGAACGCTTTCACAGCACCAAGTGTTTTGCTTTCATGGAAATGGGATGAAATAAGGGTCGGGGGCGAATCCTAAATAAACCTCTTACAAGAAACCAAC
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGACATGAACAAGATCCTGCAGAAATGGGGCGCCAGCCTGAGGAAGGGAACTGACTTTGACTCGTGGGGGCAACTGGTGGAGGCCATTGATGAGTATCAGATATTAGCAAGGCAGCTCCAGAAAGAAGCCCAGTCTCCAGCCAACTCCTCTGACTTTACGGAAGATCAGAAGAAAACCATTGGAAAGATCGCAACATGCCTGGAACTCCGCAGCGCTGCCCTACAGTACACGCAGTCCCAGGAGGGCTTCACGCTGGAGGATGTAAAGAAACTGGAACCAATTTTAAGCTCCATTCTCACCTTCAACAAAGAATTCCCCTTTGATGTACAGCCTGTTCCGTTAAGGAGGATTTTAGCGCCTGGGGAAGAGGAGAATTTAGAAGTAGAAGAAGAGGAAGAAGATGGCGGGGCCGGAGCTGGGTCTCCTGATTTGTTTCCTGCCCGTGTTCCAGGTACGCTCTTACCCAGACTGCCATCTGAACCCGGAATGACGTTACTAACAATTAAAATTGAGAAGATTGGCTTGAAAGATGCGGGACAGTGTATTGATCCTTACATTACTGTTAGTGTAAAGGATTTAAATGGAATCGACTTGACTCCAGTACAAGACACCCCCATGGCCGTGAGGAAAGAAGATACTTATGTCCATTTTAATGTTGAAATTGAAATCCAGAAACACGTGGAAAAACTTACAAAAGGGGCAGCTATTTTCTTTGAATTTCAGCACTACNAACCGAAGAACGCTTTCACAGCACCAAGTGTTTTGCTTTCATGGAAATGGGATGAAATAAGGGTCGGGGGCGAATCCTAAATAAACCTCTTACAAGAAACCAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGACATGAACAAGATCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829806
dbEST ID: 79647508
Trimmed Sequence: GTCCTTGAGCAGAGTCTGAAGCAGGTGCAGGTAGAGAGGCTTCTTTGTCAGTAACTGTAGTCTCTTCCTTTTAAAGTCAGTTGGTTTCTTGTAGAGTTCTATTACGATCTGCCCCGACCTTATCTCATCCATTTCCATGAAAGCAAAACACTTGGTGCTGGTGAAGCGTTTCTTCGGTTTGTAGTGCTTGAATTCAAAGAAAATAGCTGCCCCTTTTGTAAGTTTTTCCACGTGTTTCTGGATTTCAATTTCAACATTAAAATGGACATAAGTATCTTCTTTCCTCACGGCCATGGGGGTGTCTTGTACTGGAGTCAAGTCGATTCCATTTAAATCCTTTACACTAACAGTAATGTAAGGATCAATACACTGTCCCGCATCTTTCAAGCCAATCTTCTCAATTTTAATTGTTAGTAACGTCATTCCGGGTTCAGATGGCAGTCTGGGTAAGAGCGTACCTGGAACACGGGCAGGAAACAAATCAGGAGACCCAGCTCCGGCCCCGCCATCTTCTTCCTCTTCTTCTACTTCTAAATTCTCCTCTTCCCCAGGCGCTAAAATCCTCCTTAACGGAACAGGCTGTACATCAAAGGGGAATTCTTTGTTGAAGGTGAGAATGGAGCTTAAAATTGGGTTCAGTTTTCTTACATCCTCCAGCGTGAAGCCCTCTTGGGACTGCGTGTACTGTAGGGCAGCGCTGCGGAGTTTCCAGGCATGGTGGCGATCTTTTCCATGGTTTTTTCTTCTGAATCCTCCCTTAAAAGTCCAAA
Full Trace Sequence: GCCAGTGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTTGAGCAGAGTCTGAAGCAGGTGCAGGTAGAGAGGCTTCTTTGTCAGTAACTGTAGTCTCTTCCTTTTAAAGTCAGTTGGTTTCTTGTAGAGTTCTATTACGATCTGCCCCGACCTTATCTCATCCATTTCCATGAAAGCAAAACACTTGGTGCTGGTGAAGCGTTTCTTCGGTTTGTAGTGCTTGAATTCAAAGAAAATAGCTGCCCCTTTTGTAAGTTTTTCCACGTGTTTCTGGATTTCAATTTCAACATTAAAATGGACATAAGTATCTTCTTTCCTCACGGCCATGGGGGTGTCTTGTACTGGAGTCAAGTCGATTCCATTTAAATCCTTTACACTAACAGTAATGTAAGGATCAATACACTGTCCCGCATCTTTCAAGCCAATCTTCTCAATTTTAATTGTTAGTAACGTCATTCCGGGTTCAGATGGCAGTCTGGGTAAGAGCGTACCTGGAACACGGGCAGGAAACAAATCAGGAGACCCAGCTCCGGCCCCGCCATCTTCTTCCTCTTCTTCTACTTCTAAATTCTCCTCTTCCCCAGGCGCTAAAATCCTCCTTAACGGAACAGGCTGTACATCAAAGGGGAATTCTTTGTTGAAGGTGAGAATGGAGCTTAAAATTGGGTTCAGTTTTCTTACATCCTCCAGCGTGAAGCCCTCTTGGGACTGCGTGTACTGTAGGGCAGCGCTGCGGAGTTTCCAGGCATGGTGGCGATCTTTTCCATGGTTTTTTCTTCTGAATCCTCCCTTAAAAGTCCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTTGAGCAGAGTCTGAA