ORFeome > ak2 ORF1 – XORFeome v1.0

ak2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ak2
Gene ID: 6254479
Gene Page ID: 491597
ORF Xenbase ID: 17263641

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041509
Original XGC clone length: 726

Human orthology & disease relationships

NCBI Entrez ID: 204
Ensembl gene IDs: ENSG00000004455,ENSG00000185839,LRG_133
Directly associated (OMIM) disease MIM numbers: 267500
Indirectly associated (Lage, et al.) disease MIM numbers: 608093,608540,608799

Library Location

Plate ID: GDExl11011
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ823887
dbEST ID: 79641589
Trimmed Sequence: ATGGCTCCTAGGGAAGCTGCTCCCGCAGAGCGGGGATCGATGATGGAAGGCATTCGTGCCATTTTGCTGGGGCCACCAGGGGCCGGGAAGGGGACTCAGGCTCCAAAGCTGGCAGAGAAATACTGTGTGTGCCACCTTGCCACAGGGGATATGTTAAGGGCAATGGTGGCTTCAGGCTCGGAACTGGGCAAGCGTTTAAAGGCCACAATGGATGCAGGCAAGCTGGTCAGTGACGAGATGGTGGTGGAGCTAATTGAGAAGAATCTGGACACTCCCCCCTGTAAGAAAGGATTTCTTTTGGATGGATTTCCTCGCACTGTGAAACAAGCAGAAATGCTGGATGAGCTTCTGGAAAAGCGTCAAGAGAAGTTGGATTCTGTGATAGAATTTAAAGTGGATGATTCTTTGCTTGTGCGCAGGATATGTGGCAGGCTTATACATGCATCAAGTGGGCGTTCCTACCATGAGGAATTCAATCCTCCCAAGGAACCAATGAAAGATGATGTGACTGGAGAGGCTCTTATTCGGCGTTCGGATGACAATGAATCAACACTGAAGTCTCGGCTAGAAGCGTATCACACAATGACCTCTCCATTGGTGGATTATTACCAACGTCACGGCATTCACACAGCAGTTGATGCAGCTCAGTCTCCNGGATGTTGTGTTTGCCAGTATACTGGCAGCATTCTCCAAAGCTCACTGTAAAGAACTTGGTTTTTGTTTGGTGTGGCCAACTTCCTTGTAACAAGGTGGGCATTATTAAAAAAACAATGGCTTTAATCAATTTTGTTGCCACCCAAAAGGGTCACTATTCAATTCAAAATAAAAA
Full Trace Sequence: CAATAATGGATTTCATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTAGGGAAGCTGCTCCCGCAGAGCGGGGATCGATGATGGAAGGCATTCGTGCCATTTTGCTGGGGCCACCAGGGGCCGGGAAGGGGACTCAGGCTCCAAAGCTGGCAGAGAAATACTGTGTGTGCCACCTTGCCACAGGGGATATGTTAAGGGCAATGGTGGCTTCAGGCTCGGAACTGGGCAAGCGTTTAAAGGCCACAATGGATGCAGGCAAGCTGGTCAGTGACGAGATGGTGGTGGAGCTAATTGAGAAGAATCTGGACACTCCCCCCTGTAAGAAAGGATTTCTTTTGGATGGATTTCCTCGCACTGTGAAACAAGCAGAAATGCTGGATGAGCTTCTGGAAAAGCGTCAAGAGAAGTTGGATTCTGTGATAGAATTTAAAGTGGATGATTCTTTGCTTGTGCGCAGGATATGTGGCAGGCTTATACATGCATCAAGTGGGCGTTCCTACCATGAGGAATTCAATCCTCCCAAGGAACCAATGAAAGATGATGTGACTGGAGAGGCTCTTATTCGGCGTTCGGATGACAATGAATCAACACTGAAGTCTCGGCTAGAAGCGTATCACACAATGACCTCTCCATTGGTGGATTATTACCAACGTCACGGCATTCACACAGCAGTTGATGCAGCTCAGTCTCCNGGATGTTGTGTTTGCCAGTATACTGGCAGCATTCTCCAAAGCTCACTGTAAAGAACTTGGTTTTTGTTTGGTGTGGCCAACTTCCTTGTAACAAGGTGGGCATTATTAAAAAAACAATGGCTTTAATCAATTTTGTTGCCACCCAAAAGGGTCACTATTCAATTCAAAATAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCCTAGGGAAGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829196
dbEST ID: 79646898
Trimmed Sequence: CACAAACAAAACAAGGTCTTTACAGTGAGCTTTGGAGAATGCTGCCAGTATACTGGCAAACACAACATCCGGAGACTGAGCTGCATCAACTGCTGTGTGAATGCCGTGACGTTGGTAATAATCCACCAATGGAGAGGTCATTGTGTGATACGCTTCTAGCCGAGACTTCAGTGTTGATTCATTGTCATCCGAACGCCGAATAAGAGCCTCTCCAGTCACATCATCTTTCATTGGTTCCTTGGGAGGATTGAATTCCTCATGGTAGGAACGCCCACTTGATGCATGTATAAGCCTGCCACATATCCTGCGCACAAGCAAAGAATCATCCACTTTAAATTCTATCACAGAATCCAACTTCTCTTGACGCTTTTCCAGAAGCTCATCCAGCATTTCTGCTTGTTTCACAGTGCGAGGAAATCCATCCAAAAGAAATCCTTTCTTACAGGGGGGAGTGTCCAGATTCTTCTCAATTAGCTCCACCACCATCTCGTCACTGACCAGCTTGCCTGCATCCATTGTGGCCTTTAAACGCTTGCCCAGTTCCGAGCCTGAAGCCACCATTGGCCTTTACATATCCCCTGTGGGCAGGTGGCACACACATTATTTCTCTGCCAGCTTTGGAAGCC
Full Trace Sequence: CCTGCCGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACAAACAAAACAAGGTCTTTACAGTGAGCTTTGGAGAATGCTGCCAGTATACTGGCAAACACAACATCCGGAGACTGAGCTGCATCAACTGCTGTGTGAATGCCGTGACGTTGGTAATAATCCACCAATGGAGAGGTCATTGTGTGATACGCTTCTAGCCGAGACTTCAGTGTTGATTCATTGTCATCCGAACGCCGAATAAGAGCCTCTCCAGTCACATCATCTTTCATTGGTTCCTTGGGAGGATTGAATTCCTCATGGTAGGAACGCCCACTTGATGCATGTATAAGCCTGCCACATATCCTGCGCACAAGCAAAGAATCATCCACTTTAAATTCTATCACAGAATCCAACTTCTCTTGACGCTTTTCCAGAAGCTCATCCAGCATTTCTGCTTGTTTCACAGTGCGAGGAAATCCATCCAAAAGAAATCCTTTCTTACAGGGGGGAGTGTCCAGATTCTTCTCAATTAGCTCCACCACCATCTCGTCACTGACCAGCTTGCCTGCATCCATTGTGGCCTTTAAACGCTTGCCCAGTTCCGAGCCTGAAGCCACCATTGGCCTTTACATATCCCCTGTGGGCAGGTGGCACACACATTATTTCTCTGCCAGCTTTGGAAGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAAACAAAACAAGGTCTTTACA