ORFeome > akr1c2 ORF2 – XORFeome v1.0

akr1c2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: akr1c2
Gene ID: 5844251
Gene Page ID: 5844203
ORF Xenbase ID: 17263719

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123159
Original XGC clone length: 975

Human orthology & disease relationships

NCBI Entrez ID: 1646
Ensembl gene IDs: ENSG00000151632
Directly associated (OMIM) disease MIM numbers: 614279
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F11

Sequences - 5ʹ (forward) EST

Accession: JZ838170
dbEST ID: 79655872
Trimmed Sequence: ATGGCGCTGCACAAAGACTCCTACGTTCCGCTCAATGATGGAAACAAAATGCCAGTGATTGGCTATGGCACCTACGCCCCACAGAAGGTCCCCAAGAGCCTGGCAGAGGAGAGCACAAAGACGGCCATAGATGTTGGATACCGCCATGTTGACTCTGCGTTTATGTATCAGAATGAAGTGGAGGTTGGACGGGCCATTAGGATGAAGATTGCTGATGGTACAGTGAAGAGAGAGGATTTGTTTTACACCGGGAAGCTATGGAGCAATTTCCACACTCCTGAGATGGTCCGCCAAGGGCTTGAGAAATCTCTGAAAGATCTTCATTTGGACTACATGGACCTCTTTATCATCCACATACCAATAGAGTTCAAGCCTGGAGATGATCCCTTTCCAGTGGATGAAAATGGAAAATTTCTTTATCATAACACAGACCTTCGAGATACATGGAAGGCTATGGAAGCAGTGAAAGACACAGGGTTGGTCAAATCCATTGGAGTCTCCAACTTTAACAAGCGACAGCTGGAGTGGATCCTCAACATGCCTGGACTAGGGTATAAACCTGTCTGTGATCAGGTGGAATGTCACATCTTCCTGAACCATAGCAAACTACTAGCGGTCTGCTAGTCCAGGATATTGTGCTGGGGGGAGCGGGGGAATGGGGGTCCGGGGGGGGATAAGAAAGGATAAAAAAAAATTCTACTAATACCCTGGAAAAACCCCAAAAAACAATCAGGGGGCTAAAAAAGCAAAACAAAAACCACAGCCC
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGCACAAAGACTCCTACGTTCCGCTCAATGATGGAAACAAAATGCCAGTGATTGGCTATGGCACCTACGCCCCACAGAAGGTCCCCAAGAGCCTGGCAGAGGAGAGCACAAAGACGGCCATAGATGTTGGATACCGCCATGTTGACTCTGCGTTTATGTATCAGAATGAAGTGGAGGTTGGACGGGCCATTAGGATGAAGATTGCTGATGGTACAGTGAAGAGAGAGGATTTGTTTTACACCGGGAAGCTATGGAGCAATTTCCACACTCCTGAGATGGTCCGCCAAGGGCTTGAGAAATCTCTGAAAGATCTTCATTTGGACTACATGGACCTCTTTATCATCCACATACCAATAGAGTTCAAGCCTGGAGATGATCCCTTTCCAGTGGATGAAAATGGAAAATTTCTTTATCATAACACAGACCTTCGAGATACATGGAAGGCTATGGAAGCAGTGAAAGACACAGGGTTGGTCAAATCCATTGGAGTCTCCAACTTTAACAAGCGACAGCTGGAGTGGATCCTCAACATGCCTGGACTAGGGTATAAACCTGTCTGTGATCAGGTGGAATGTCACATCTTCCTGAACCATAGCAAACTACTAGCGGTCTGCTAGTCCAGGATATTGTGCTGGGGGGAGCGGGGGAATGGGGGTCCGGGGGGGGATAAGAAAGGATAAAAAAAAATTCTACTAATACCCTGGAAAAACCCCAAAAAACAATCAGGGGGCTAAAAAAGCAAAACAAAAACCACAGCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGCACAAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838169
dbEST ID: 79655871
Trimmed Sequence: ATATTCATCAGTAAATGGGTATTTAGGATGGTCCGCAAATTGCTTTAAATCCACATAGCGCACGTCTTTATTGACTCCATTAAGGGTTTCCATTTCTTCAGCATTTAATTGGAAATCAAAAAGCTGGAAGTTCTGCTGGATCCTGGCAGGGGTAAAGCTCTTTGCAAGGACGACGACTCCTCGCTGGAGCAGGTACCGCATTGCTACCTGAGCGGGGGTCCGATTGTGCTTCTTAGCGACTGCATTCAACACGGGGTCTTCCAGGAGCACAGGAGAATTCTGATCTATCCAGTTCTCATCCCTGCTGGACCCCAATACGCTGTATCCCACCAGCACAATATCCTTGGACTTGCAGAACGCCAGCAGTTTGCTCTGGTTCAGGAAGATGTGACATTCCACCTGATTACAGACAGGTTTATACTTTAGTCCAGGCATGCTGAGGATCCACTCCAGCTGTCGCTTGTTAAAGTTGGAGACTCCAATGGATTTGACCAACCCTGTGTCTTTCACTGCTTCCATAGCCTTCCATGTATCTCGAAGGTCTGTGTTATGATAAAGAAATTTTCCATTTTCATCCACTTGCAAAGGGATCATCCCCCGCGCTTGAACTCTATTGGTTATGTGGAATGATAAAGAAAGATCAATGTAAGTCCAAAATAAAAAATTTTTTCAAAAAATTTCTTCAAGCCCCTTTGGCGGAACCAATCTCAGGGAAGGAATAAGAAAAATGGGATGCCATAAACCTCCCCCCGGGTGTTGAAAAACAAAAATCCCGCCCTCACCCTT
Full Trace Sequence: GAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATATTCATCAGTAAATGGGTATTTAGGATGGTCCGCAAATTGCTTTAAATCCACATAGCGCACGTCTTTATTGACTCCATTAAGGGTTTCCATTTCTTCAGCATTTAATTGGAAATCAAAAAGCTGGAAGTTCTGCTGGATCCTGGCAGGGGTAAAGCTCTTTGCAAGGACGACGACTCCTCGCTGGAGCAGGTACCGCATTGCTACCTGAGCGGGGGTCCGATTGTGCTTCTTAGCGACTGCATTCAACACGGGGTCTTCCAGGAGCACAGGAGAATTCTGATCTATCCAGTTCTCATCCCTGCTGGACCCCAATACGCTGTATCCCACCAGCACAATATCCTTGGACTTGCAGAACGCCAGCAGTTTGCTCTGGTTCAGGAAGATGTGACATTCCACCTGATTACAGACAGGTTTATACTTTAGTCCAGGCATGCTGAGGATCCACTCCAGCTGTCGCTTGTTAAAGTTGGAGACTCCAATGGATTTGACCAACCCTGTGTCTTTCACTGCTTCCATAGCCTTCCATGTATCTCGAAGGTCTGTGTTATGATAAAGAAATTTTCCATTTTCATCCACTTGCAAAGGGATCATCCCCCGCGCTTGAACTCTATTGGTTATGTGGAATGATAAAGAAAGATCAATGTAAGTCCAAAATAAAAAATTTTTTCAAAAAATTTCTTCAAGCCCCTTTGGCGGAACCAATCTCAGGGAAGGAATAAGAAAAATGGGATGCCATAAACCTCCCCCCGGGTGTTGAAAAACAAAAATCCCGCCCTCACCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATATTCATCAGTAAATGGGTA