ORFeome > akr1cl1 ORF1 – XORFeome v1.0

akr1cl1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: akr1cl1
Gene ID: 5757795
Gene Page ID: 5757726
ORF Xenbase ID: 17263725

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053793
Original XGC clone length: 975

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ839355
dbEST ID: 79657057
Trimmed Sequence: ATGGCACTGCACAAAGACTCCTATGTTGTACTCAGTGATGGGCACAAAATGCCAGTGATTGGATTTGGAACATTTGCCCCACAGAAGGTCCCCAAGAACCTGGCCGAGGAGGGCGTCAAAGTGGCCATCGACGTTGGATACCGCCATATTGACTGTGCTTTTATCTACGGGAACGAGGTGGAGGTTGGACGGGCGATAAGAGCAAAGATTGCCGATGGTACAGTGGAGAGGGAGGACCTGTTTTACACTGGGAAGCTCTGGTCCACGTTCCAAGTCCCTGAGAAGGTCCGTCCAGCCCTGGAGAAATCTCTGAAAGATCTTCAGTTGGATTACATGGATCTTTTCATCATCCACAGCCCAATAGAGTTCAAGCCTGGAGATGACCCCTTTCCATTGGATGAAACTGGGAAATTTATTTACCATAACACAGACATTCGAGATACATGGAAGGCTCTGGAAGAGTGCAAAGACGCCGGGCTGGTCAGATCCATCGGGGTGTCCAATTTTAACCACAAGCAGCTGGAGCTGATCCTCAATATGCCTGGCCTGAAATATAAACCCATCTGTAACCAGGTGGAATGTCACATCTTACTGAACCAGAGCAAACTGCTGGAGTTCTGCCAGTCCAAGGACATCGTGCTGGTGGGATACAGTGTATTGGGGTCCAGCAGAGAAGAACCATGGAAAAATCAAAATTCTCCTGTTGCTTCGGAAAAACCCCGTGGTGAAATGCAGTTCGCCTAAAAAAACCAAAATCCGAACCCCCCCCCTTCAAGGTAACCAATGGGGGGGGTACCCTGGC
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCACTGCACAAAGACTCCTATGTTGTACTCAGTGATGGGCACAAAATGCCAGTGATTGGATTTGGAACATTTGCCCCACAGAAGGTCCCCAAGAACCTGGCCGAGGAGGGCGTCAAAGTGGCCATCGACGTTGGATACCGCCATATTGACTGTGCTTTTATCTACGGGAACGAGGTGGAGGTTGGACGGGCGATAAGAGCAAAGATTGCCGATGGTACAGTGGAGAGGGAGGACCTGTTTTACACTGGGAAGCTCTGGTCCACGTTCCAAGTCCCTGAGAAGGTCCGTCCAGCCCTGGAGAAATCTCTGAAAGATCTTCAGTTGGATTACATGGATCTTTTCATCATCCACAGCCCAATAGAGTTCAAGCCTGGAGATGACCCCTTTCCATTGGATGAAACTGGGAAATTTATTTACCATAACACAGACATTCGAGATACATGGAAGGCTCTGGAAGAGTGCAAAGACGCCGGGCTGGTCAGATCCATCGGGGTGTCCAATTTTAACCACAAGCAGCTGGAGCTGATCCTCAATATGCCTGGCCTGAAATATAAACCCATCTGTAACCAGGTGGAATGTCACATCTTACTGAACCAGAGCAAACTGCTGGAGTTCTGCCAGTCCAAGGACATCGTGCTGGTGGGATACAGTGTATTGGGGTCCAGCAGAGAAGAACCATGGAAAAATCAAAATTCTCCTGTTGCTTCGGAAAAACCCCGTGGTGAAATGCAGTTCGCCTAAAAAAACCAAAATCCGAACCCCCCCCCTTCAAGGTAACCAATGGGGGGGGTACCCTGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACTGCACAAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839354
dbEST ID: 79657056
Trimmed Sequence: GTAGTCCTCATGAAATGGATATTTCGGGTGATCCAACCACCTGGTTGAGTCAACATAACGCAGGTTTCTGTTTAGTCCATCAAGGCTTCTCATGTCTTCATTGTCCAAGTGAAAGTCGAAAACCTGGAAGTTCTGCTGGATCCTGGCAGGGGTATAGCTCTTTGCGAGAACGACAACTCCTCGTTGGAGCAGGTACCGCATTGCTACCTGAGCGGGGGTCCGATTGTGCTTCTTAGCGACTGCATTCAACACGGGGTCTTCCAGAAGCACAGGAGAATTCTGATCTATCCATCGCTCATCTCTGCTGGACCCCAATACACTGTATCCCACCAGCACGATGTCCTTGGACTTGCAGAACTCCAGCAGTTTGCTCTGGTTCAGTAAGATGTGACATTCCACCTGGTTACAGATGGGTTTATATTTCAGGCCAGGCATATTGAGGATCAGCTCCNGCTGCTTGTGGTTAAAATTGGACACCCCGATGGATCTGACCAGCCCGGCGTCTTTGCACTCTTCCAGAGCCTTCCATGTATCTCGAATGTCTGTGTTATGGTAAATAAATTTCCCAGTTTCATCCCATGGAGAGGGGTCATTCTCCGGGTTGGAACTCTTTGGGGCTGGTGGATGAAGAAAAAAACCATGGTAATCCAACCTGAAGAATCTTTCAAAAATTTCTCCCAGGGCCTGGGAGGGACCCCTTCTCAGGGGAAATTGGGAACGGGGGGACCCAAAAACTTCC
Full Trace Sequence: GGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGTCCTCATGAAATGGATATTTCGGGTGATCCAACCACCTGGTTGAGTCAACATAACGCAGGTTTCTGTTTAGTCCATCAAGGCTTCTCATGTCTTCATTGTCCAAGTGAAAGTCGAAAACCTGGAAGTTCTGCTGGATCCTGGCAGGGGTATAGCTCTTTGCGAGAACGACAACTCCTCGTTGGAGCAGGTACCGCATTGCTACCTGAGCGGGGGTCCGATTGTGCTTCTTAGCGACTGCATTCAACACGGGGTCTTCCAGAAGCACAGGAGAATTCTGATCTATCCATCGCTCATCTCTGCTGGACCCCAATACACTGTATCCCACCAGCACGATGTCCTTGGACTTGCAGAACTCCAGCAGTTTGCTCTGGTTCAGTAAGATGTGACATTCCACCTGGTTACAGATGGGTTTATATTTCAGGCCAGGCATATTGAGGATCAGCTCCNGCTGCTTGTGGTTAAAATTGGACACCCCGATGGATCTGACCAGCCCGGCGTCTTTGCACTCTTCCAGAGCCTTCCATGTATCTCGAATGTCTGTGTTATGGTAAATAAATTTCCCAGTTTCATCCCATGGAGAGGGGTCATTCTCCGGGTTGGAACTCTTTGGGGCTGGTGGATGAAGAAAAAAACCATGGTAATCCAACCTGAAGAATCTTTCAAAAATTTCTCCCAGGGCCTGGGAGGGACCCCTTCTCAGGGGAAATTGGGAACGGGGGGACCCAAAAACTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGTCCTCATGAAATGGATATTT