ORFeome > aldh1-A ORF1 – XORFeome v1.0

aldh1-A ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254661
Gene Page ID:
ORF Xenbase ID: 17263791

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC077256
Original XGC clone length: 1509

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11029
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ825783
dbEST ID: 79643485
Trimmed Sequence: ATGTCAGAGAAAACCATTCTACATGGTTTGCCACCTCCCCTAAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTATAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAGTATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAGAGAAGCTTTCCAGATAGGGTCCCCATGGCGAAGGCTGGATGCTTCTGAAAGGGGCCGGATGCTTAATAAGTTGGCTGACCTTGTGGAACGAGATAGGTTGATTCTAAGCACCATGGAATCTATTGATGGTGGAAAGCCATATACAGCATCCTATTTTGGAGATATACCTGGAGCTATTAAATCACTCCGTTACTGTGCAGGATGGGCTGATAAAGTCCAAGGCCGTACAATACCAATGGATGGTGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCATTGGTGATGTTTGCTTGGAAAATTGCTCCTGCTCTATGCTGTGGTAACACAGTTGTCATCAAACCAACTGAACAAACTCCACTGACTGCTCTAATACTGGGGGTCTTTAATAAAAGAGGCAGGAATTCCTCCGGGGGTAGTGAATATTGTACCAAGAATTTGACCAACTTGCAGACCAACCTAATTTTTACCATTATGAAATAAAAAAAATTGGCTTTCATTGGTTTCACAAAAAGTTTGGAAAAAATGAAAAGAAAAAAACAACCAGGAAAAAAACCACACCTTATAAAACAGTCTC
Full Trace Sequence: TGAGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGAAAACCATTCTACATGGTTTGCCACCTCCCCTAAGCAACTTGGAAATAAAATACACAAAGATTTTTATAAACAATGAATGGCACAATTCTATAAGTGGAAAAAAATTTCCTGTCTACAATCCAGCTACTGGAGAGAAAGTATGTGAGGTGGAAGAAGGAGATAAGGAAGATGTGAACAAGGCTGTGAAAGCAGCAAGAGAAGCTTTCCAGATAGGGTCCCCATGGCGAAGGCTGGATGCTTCTGAAAGGGGCCGGATGCTTAATAAGTTGGCTGACCTTGTGGAACGAGATAGGTTGATTCTAAGCACCATGGAATCTATTGATGGTGGAAAGCCATATACAGCATCCTATTTTGGAGATATACCTGGAGCTATTAAATCACTCCGTTACTGTGCAGGATGGGCTGATAAAGTCCAAGGCCGTACAATACCAATGGATGGTGACTATTTTACTTTTACAAGACATGAGCCTGTTGGAGTGTGTGGTCAAATAATCCCATGGAACTTTCCATTGGTGATGTTTGCTTGGAAAATTGCTCCTGCTCTATGCTGTGGTAACACAGTTGTCATCAAACCAACTGAACAAACTCCACTGACTGCTCTAATACTGGGGGTCTTTAATAAAAGAGGCAGGAATTCCTCCGGGGGTAGTGAATATTGTACCAAGAATTTGACCAACTTGCAGACCAACCTAATTTTTACCATTATGAAATAAAAAAAATTGGCTTTCATTGGTTTCACAAAAAGTTTGGAAAAAATGAAAAGAAAAAAACAACCAGGAAAAAAACCACACCTTATAAAACAGTCTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGAGAAAACCATTCTACAT

Sequences - 3ʹ (reverse) EST

Accession: JZ825782
dbEST ID: 79643484
Trimmed Sequence: GGAATTCTTCTGAGAAATTTTCATGATAACCGTCTTGACTTCGGTGTATTCATGCAGGCCATATTCACCCATTTCACGGCCATTTCCAGACATCTTAAACCCGCCAAAAGGGCTTTGTGGGGACATGGCACTGTAACAATTTATCCACACAGTTCCAGCCTGAAGAGCCGTAGACATTAATATTGCTTTGTCCATGTCTTTGGTGAAAACTCCGGCAGCTAATCCATACTTTGTATTGTTTGCCCTTTTAATAACTTCATCGATTGTTTTAAACTTCAGGATTTGTTGCACAGGCCCAAAAATTTCTTCTTTGGCTATACGCATATCATCCTTCACATCTGAAAAGACTGTGGGGCTAATATAGAAACCTTTCTCACCCCATGCACTTCCTCCACATTGCAACTTTGCTCCTTCTTTCTTTCCACTCTCAATCAATTCAAGGATTTTGTCATATTGTTCTTTGTCAATCTGTGGTCCGTGGTTTACACATGGAGCAAAAGGATCTCCAAGTACACGTTTTTTGGCCCTTTCAACACTCTTACACACAAAATCAACATACAATTGTTCTTCCGCACACATCCCGAATCCTGCGATGCCGCACTGACCCTGATGAAAAAACAAACCATTGGGTGCCTGCTCAGCGGCCAAATCCAAGTCTCCATCCCCCAAAAAGAAAAAAAGGAGCTTTTCCGCGGGGTTTCACCTGTAAACCCCATTAAAGGGTACACACAAAACCGCCCACCAC
Full Trace Sequence: GGAAGGGGCTATGGACCGTGTAATACGACTCACTATAAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGAGAAATTTTCATGATAACCGTCTTGACTTCGGTGTATTCATGCAGGCCATATTCACCCATTTCACGGCCATTTCCAGACATCTTAAACCCGCCAAAAGGGCTTTGTGGGGACATGGCACTGTAACAATTTATCCACACAGTTCCAGCCTGAAGAGCCGTAGACATTAATATTGCTTTGTCCATGTCTTTGGTGAAAACTCCGGCAGCTAATCCATACTTTGTATTGTTTGCCCTTTTAATAACTTCATCGATTGTTTTAAACTTCAGGATTTGTTGCACAGGCCCAAAAATTTCTTCTTTGGCTATACGCATATCATCCTTCACATCTGAAAAGACTGTGGGGCTAATATAGAAACCTTTCTCACCCCATGCACTTCCTCCACATTGCAACTTTGCTCCTTCTTTCTTTCCACTCTCAATCAATTCAAGGATTTTGTCATATTGTTCTTTGTCAATCTGTGGTCCGTGGTTTACACATGGAGCAAAAGGATCTCCAAGTACACGTTTTTTGGCCCTTTCAACACTCTTACACACAAAATCAACATACAATTGTTCTTCCGCACACATCCCGAATCCTGCGATGCCGCACTGACCCTGATGAAAAAACAAACCATTGGGTGCCTGCTCAGCGGCCAAATCCAAGTCTCCATCCCCCAAAAAGAAAAAAAGGAGCTTTTCCGCGGGGTTTCACCTGTAAACCCCATTAAAGGGTACACACAAAACCGCCCACCAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGAGAAATTTTCAT