ORFeome > aldh1a2 ORF1 – XORFeome v1.0

aldh1a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aldh1a2
Gene ID: 1012914
Gene Page ID: 1012908
ORF Xenbase ID: 17263815

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128678
Original XGC clone length: 1557

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ838742
dbEST ID: 79656444
Trimmed Sequence: ATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTTAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAATAATTAAACCTGCTGAACAAACTCCCCTCACTGCTCTCTATATGGAACCCCTCATCCAAGAGGCTGGTTTTCCCCCCGGGGTTGTTTACATTTTACCAGGATAATGGTCGACTTGGCGGAACCCCGATTGCCTTCTCCCTTTTGTGCTTTAATTAAATTTTCCTTTCCTGGTTTCTATCTTAAGGGTTTGAAAATTGT
Full Trace Sequence: TCGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCCAGTAAAATAGAGATGCCCGGGGAAGTTAAGACAGATCCCGCCGCCCTGATGGCTTCTCTGCAGCTCCTGCCTTCTCCCAGCGCTAACCTAGAAGTCAAGCACAGCAAGATTTTTATAAACAATGAATGGCAGACTTCTGAGAGTGGAAAAGCTTTCCCAGTCTATAATCCAGCCACTGGGGAGCAGATCTGTGAAGTTCAAGAAGCTGAAAAGTCTGACGTAGATAAAGCAGTGCAAGCTGCCCGACTGGCTTTTGCATTAGGTTCTGTGTGGAGGAGAATGGATGCCTCAGAAAGGGGGCGGCTGCTGGATAAATTGGCTGATCTGATTGAAAGAGAGAGGACTGCTCTTGCGACCCTTGAATCTCTAAACAGTGGCAAACCATTTTTACAGTCTTATTATGTGGATCTCCAAGGTGCTATCAAAACATTCAGATACTATGCTGGCTGGGCCGACAAGATACATGGACTGACTATCCCAGCAGATGGAGATTACTTAACGTTTACGAGACATGAACCCATTGGCGTGTGTGGTCAGATCATCCCATGGAACTTCCCCCTGCTGATGTTTGCCTGGAAGATTGCTCCTGCCCTGTGCTGTGGGAATACTGTAATAATTAAACCTGCTGAACAAACTCCCCTCACTGCTCTCTATATGGAACCCCTCATCCAAGAGGCTGGTTTTCCCCCCGGGGTTGTTTACATTTTACCAGGATAATGGTCGACTTGGCGGAACCCCGATTGCCTTCTCCCTTTTGTGCTTTAATTAAATTTTCCTTTCCTGGTTTCTATCTTAAGGGTTTGAAAATTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCCAGTAAAATAGAGATG

Sequences - 3ʹ (reverse) EST

Accession: JZ838741
dbEST ID: 79656443
Trimmed Sequence: GGAATTCTTCTGGGGAATCTTTATAGTCACTGTTTTTGCTTCGGTGTACTCCCTTAGTCCATACTCTCCCATTTCTCTTCCATTGCCAGACATTTTGTAGCCTCCAAATGGGCTTTGAGCATTCAGAGCATTGTAACAATTTATCCAAACAGTTCCTGCTTGCATTGCTGAAGAAACAGTCAAGGCTTTGTTGATATCATTGGTAAAAACAGCTGCTACTAGACCATAATCAGAATTGTTGGCTCTTTCAATAACTTCCTCAACAGTTTTAAACCTTAATATTTGTTGAACAGGTCCAAAAATCTCTTCTCTGGCAATCCGCATATCATCTGCTACATTGGAAAAGACTGTTGGTTCTATAAAAAATCCTTTTCTTCCCAATGCTTTTCCACCGCATTCCAGCTTAGCTCCTTCAGTTATTCCACTCTGAATAAGTTCCAGTATTTTGTTGTATTGCTTTTTATTAGTCTGGGGTCCTTGCTCTGTAGTGGGATCAAAAGGGCTTCCAACTATTCTTCTCTTGGCACGTTCAACACTTCTTCGAACAAACTCCTCATAAATGGAATCTTCTACGAATGTCCGCGAGCCAGCAGTACAGCACTGTCCTTGGTTAAGACAACACCTTGGTGTGCTTGTCAACTGCATAGTCCAAATCCGCATCAACAAAAAAAATGTTGGGGCTCTTCCTTCCTAAATTTAGAAATGAATCCCTTCCAAATTCTTTTTTCCCACCTCCCTTTTTGAATTACATTTCCCACCCCTTTCTAAAAAACCACTGGAAAAGCAAATT
Full Trace Sequence: AGCGAGTGGTTAATACGACTCACTATGAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGGGGAATCTTTATAGTCACTGTTTTTGCTTCGGTGTACTCCCTTAGTCCATACTCTCCCATTTCTCTTCCATTGCCAGACATTTTGTAGCCTCCAAATGGGCTTTGAGCATTCAGAGCATTGTAACAATTTATCCAAACAGTTCCTGCTTGCATTGCTGAAGAAACAGTCAAGGCTTTGTTGATATCATTGGTAAAAACAGCTGCTACTAGACCATAATCAGAATTGTTGGCTCTTTCAATAACTTCCTCAACAGTTTTAAACCTTAATATTTGTTGAACAGGTCCAAAAATCTCTTCTCTGGCAATCCGCATATCATCTGCTACATTGGAAAAGACTGTTGGTTCTATAAAAAATCCTTTTCTTCCCAATGCTTTTCCACCGCATTCCAGCTTAGCTCCTTCAGTTATTCCACTCTGAATAAGTTCCAGTATTTTGTTGTATTGCTTTTTATTAGTCTGGGGTCCTTGCTCTGTAGTGGGATCAAAAGGGCTTCCAACTATTCTTCTCTTGGCACGTTCAACACTTCTTCGAACAAACTCCTCATAAATGGAATCTTCTACGAATGTCCGCGAGCCAGCAGTACAGCACTGTCCTTGGTTAAGACAACACCTTGGTGTGCTTGTCAACTGCATAGTCCAAATCCGCATCAACAAAAAAAATGTTGGGGCTCTTCCTTCCTAAATTTAGAAATGAATCCCTTCCAAATTCTTTTTTCCCACCTCCCTTTTTGAATTACATTTCCCACCCCTTTCTAAAAAACCACTGGAAAAGCAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATTCTTCTGGGGAATCT