ORFeome > aldh2 ORF1 – XORFeome v1.0

aldh2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aldh2
Gene ID: 866006
Gene Page ID: 490835
ORF Xenbase ID: 17263827

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC077908
Original XGC clone length: 1566

Human orthology & disease relationships

NCBI Entrez ID: 217
Ensembl gene IDs: ENSG00000111275
Directly associated (OMIM) disease MIM numbers: 610251
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,151623,180849,227650,229100,230350,231300,236250,237300,250940,259900,260500,268300,270200,271980,275355,300000,300068,307030,308370,312300,313200,600121,600794,601472,604229,605899,606054,606664,608643,608688,608902,609015,609535

Library Location

Plate ID: GDExl11041
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ827744
dbEST ID: 79645446
Trimmed Sequence: ATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAAAAAGCTGGAATTCCCTCCCGGGTGTTGTTAAATATCAATTACTGGAAATGGGTTCCCACAAGCTGGTTTCAGCTTTTCTTCTTTCTCCAATTGGAAATTTTGGAAAAAAAAGT
Full Trace Sequence: TCTAGGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTCCGGTCAGTCTTGGGGAGCCTCTACGGCAAGGTGTCTCGTGTACCTCTGGGGCTACAGCTCTGCAGATATTCCGTTGCCATACCAACCCCCAACCCTAAGCCAGATGTGCACTTCAACCAGCTCTTTATCAACAATGAGTGGCATGATGCTGTCAGCAAGAAGACCTTCCCCACCATCAACCCATCTACAGCAGAAGTGATATGCCATATTGCAGAAGGAGACAAAGCTGATGTGGACAAAGCAGTTAAAGCTGCACGCGAGGCATTCAGATTGGGATCACCATGGAGGAGAATGGATGCATCTCAAAGGGGTGTTCTGATAAACCGTCTGGCAGATCTTATTGAAAGAGACAGAGCTATATTGGCAACCTTGGAGACTTTAGACAATGGAAAGCCATATGCAATTTCCTATGCAGTGGACTTGGATCTTGTACTAAAATGCCTAAGATATTATGCAGGCTGGGCTGACAAATGTCATGGAAAGACGATCCCAATCGATGGAGATTATTTTACCTACACCAGACATGAACCTGTCGGAGTGTGTGGACAGATCATTCCGTGGAATTTTCCTCTTCTAATGCTTGCTTGGAAATTTGGACCTGCTCTGGCCACTGGAAATGTGATTGTCATGAAGGTGGCTGAGCAGACCCCTCTCTCTGCTCTGCATGTTGCTAGCCTTGTGAAAAAAAGCTGGAATTCCCTCCCGGGTGTTGTTAAATATCAATTACTGGAAATGGGTTCCCACAAGCTGGTTTCAGCTTTTCTTCTTTCTCCAATTGGAAATTTTGGAAAAAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCCGGTCAGTCTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ827745
dbEST ID: 79645447
Trimmed Sequence: AGAATTCTTCTGGGGAATCTTAATGGTGACATTCTTCACTTCTGTGTATGCTTCAAGTCCATACTCTCCAAGCTCTCTCCCTATTCCTGATGCCTTGTACCCTCCAAAGGGGGCTTGAGCTCCAAAAACATCATAGCAGTTAATCCAGACAGTACCAGCTCTTACTGACTGAGAGAAAGTGTGAGCTTTATCAATGTCCTTTGTAAACACTGCCGCTGCCAGACCATACATTGAGTTGTTGGCTCGGTCGATCACCTCTTCAATTGATTTAAACTTTAGAATTTGCATCACAGGTCCAAAAATCTCTTCTCTAGCAATGGTCATGTTGTCAGTCACATCTCCAAAAACGGTGGGCTGGATAAAATAGCCTCGATCAGCAGCAGGATTACCACCATAGAGAAGCTTTGCACCTTCCTTTTTCCCAGATTTTATATACCCCAGAATTTTATTAAACTGTTCCTCATCCACCTGAGGTCCTTGCTCTGTTTTGAAGTCAAAGGGGTTCCCAACAATCCTATTCTTTGCTCTTTGTATGCTCCTCTCAACAAACTCAGTGTAGATATCTTCCTGAACATAAGTGCGAAAGCCAGCACAGCAGCACTGGCCCCTGGTTAAGAAAAGGGCAAAATGGGGCTGCTCCGCAACCCATCCAAATCTGCATCACAAAAAAAAATTATTGGGCTCTTCCCACCCAGTTTCCGGTGTCACTTTTTTTTTAATTTTCTTTTTCCCCACCTCCCTTTTTGGAATTTTAAAGAACGAACCC
Full Trace Sequence: GAAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAATTCTTCTGGGGAATCTTAATGGTGACATTCTTCACTTCTGTGTATGCTTCAAGTCCATACTCTCCAAGCTCTCTCCCTATTCCTGATGCCTTGTACCCTCCAAAGGGGGCTTGAGCTCCAAAAACATCATAGCAGTTAATCCAGACAGTACCAGCTCTTACTGACTGAGAGAAAGTGTGAGCTTTATCAATGTCCTTTGTAAACACTGCCGCTGCCAGACCATACATTGAGTTGTTGGCTCGGTCGATCACCTCTTCAATTGATTTAAACTTTAGAATTTGCATCACAGGTCCAAAAATCTCTTCTCTAGCAATGGTCATGTTGTCAGTCACATCTCCAAAAACGGTGGGCTGGATAAAATAGCCTCGATCAGCAGCAGGATTACCACCATAGAGAAGCTTTGCACCTTCCTTTTTCCCAGATTTTATATACCCCAGAATTTTATTAAACTGTTCCTCATCCACCTGAGGTCCTTGCTCTGTTTTGAAGTCAAAGGGGTTCCCAACAATCCTATTCTTTGCTCTTTGTATGCTCCTCTCAACAAACTCAGTGTAGATATCTTCCTGAACATAAGTGCGAAAGCCAGCACAGCAGCACTGGCCCCTGGTTAAGAAAAGGGCAAAATGGGGCTGCTCCGCAACCCATCCAAATCTGCATCACAAAAAAAAATTATTGGGCTCTTCCCACCCAGTTTCCGGTGTCACTTTTTTTTTAATTTTCTTTTTCCCCACCTCCCTTTTTGGAATTTTAAAGAACGAACCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAATTCTTCTGGGGAATCTTAAT