ORFeome > aldoa ORF1 – XORFeome v1.0

aldoa ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aldoa
Gene ID: 959797
Gene Page ID: 959790
ORF Xenbase ID: 17263863

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046673
Original XGC clone length: 1095

Human orthology & disease relationships

NCBI Entrez ID: 226
Ensembl gene IDs: ENSG00000149925
Directly associated (OMIM) disease MIM numbers: 611881
Indirectly associated (Lage, et al.) disease MIM numbers: 125800,164300,194050,212065,219100,248500,248600,312170,602485,602579,606003

Library Location

Plate ID: GDExl11012
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ823962
dbEST ID: 79641664
Trimmed Sequence: ATGCCTCACCAATACCCAGCACTGACCCCCGAGCAGAAGAAGGAGCTCCATGACATCGCCAAACGCATTGTGGCTCCTGGCAAGGGCATCCTGGCAGCCGATGAGTCCACAGGCAGCATTGCTAAGCGCTTGAGTTCCATTGGGGCAGAGAACACCGAGGAGAACCGTCGCTTTTACCGCCAGTTGCTCTTCACGGCCGACGAAAAAGTGAACCCCTGCATCGGGGGCGTCATCACCTTCCACGAGACCCTCTACCACAAGACCGACGATGGCGTGGCCTTCACCAAAGTCATCAAGGACAAAGGGGGTGTCGTAGGCATCAAGGTTGATAAAGGTGTCGTCCCTCTGGCTGGAACCAACGGTGAAACCACAACTCAAGGTCTGGATGGACTGTCCGAGCGCTGTGCCCAGTACAAGAAAGATGGCGCTGACTTTGCCAAGTGGCGCTCCGTGCTCAAGATCTCTGAACACACCCCCTCTCACCTGGCCATCATAGAGAATGCCAACGTATTGGCCCGTTACGCCAGCATCTGCCAACAGAATGGAATTGTGCCCATTGTGGAGCCCGAGGTCCTTCCTGATGGAGAACATGACCTGAAGAGGTGCCAGTACGTGACAGAGAAGGTTCTGGCTGCAGTCTACAAGGCTCTCAGCGACCATCACGTTTACCTGGAAGGGACCCTGCTGAAACCAAACATGGTTACCCCCGGGCACGCCTGCACCAAGAAGTACCCCCCCTCAGGAGATT
Full Trace Sequence: CCAGATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTCACCAATACCCAGCACTGACCCCCGAGCAGAAGAAGGAGCTCCATGACATCGCCAAACGCATTGTGGCTCCTGGCAAGGGCATCCTGGCAGCCGATGAGTCCACAGGCAGCATTGCTAAGCGCTTGAGTTCCATTGGGGCAGAGAACACCGAGGAGAACCGTCGCTTTTACCGCCAGTTGCTCTTCACGGCCGACGAAAAAGTGAACCCCTGCATCGGGGGCGTCATCACCTTCCACGAGACCCTCTACCACAAGACCGACGATGGCGTGGCCTTCACCAAAGTCATCAAGGACAAAGGGGGTGTCGTAGGCATCAAGGTTGATAAAGGTGTCGTCCCTCTGGCTGGAACCAACGGTGAAACCACAACTCAAGGTCTGGATGGACTGTCCGAGCGCTGTGCCCAGTACAAGAAAGATGGCGCTGACTTTGCCAAGTGGCGCTCCGTGCTCAAGATCTCTGAACACACCCCCTCTCACCTGGCCATCATAGAGAATGCCAACGTATTGGCCCGTTACGCCAGCATCTGCCAACAGAATGGAATTGTGCCCATTGTGGAGCCCGAGGTCCTTCCTGATGGAGAACATGACCTGAAGAGGTGCCAGTACGTGACAGAGAAGGTTCTGGCTGCAGTCTACAAGGCTCTCAGCGACCATCACGTTTACCTGGAAGGGACCCTGCTGAAACCAAACATGGTTACCCCCGGGCACGCCTGCACCAAGAAGTACCCCCCCTCAGGAGATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCACCAATACCCAGCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829271
dbEST ID: 79646973
Trimmed Sequence: GTAGGCGTGGTTTGATACGAAGAGGGATTCTCCTGCAGCAGCTCCTGCATCTCCGCTGGCTACATATTTTCCTTGGCACGCCAGGCTGTTGGCCAGGGCGCGCTTGATGTACTCATCCTGAGCCTTCTTGGTGTTCTCCTTCTTGCCCCCCCAAGCTTTGAGGGCAGAGGCCTGAAGGGCACGTCCGTAGGAGAAGGTCAGGGGCCAGGGTTTGAGCAGGGGGCACTGGTTGATGGCATTCAGGTGCACCGTGGCCTCTTCCTCACTTTGTCCTCCAGACAGGAAGGTGATTCCTGCAACAGCAGGGGGCACTGTGCGCCTGAGGGCGGTGACTGTTGCCATGGCAATCTCCTGAGGGGGGTACTTCTTGGTGCAGGCGTGCCCGGGGGTAACCATGTTTGGTTTCAGCAGGGTCCCTTCCAGGTAAACGTGATGGTCGCTGAGAGCCTTGTAGACTGCAGCCAGAACCTTCTCTGTCACGTACTGGCACCTCTTCAGGTCATGTTCTCCATCANGAAGGACCTCGGGCTCCACAATGGGCACAATTCCATTCTGTTGGCAGATGCTGGCGTAACGGGGCAATACGTTGGCATTCTCTATGATGGCCAGGTGAGAGGGGGGTGTGTTCAGAGATCTTGAGCACGGAGCGCCCCTTGGCAAAGTCAGCCGCCATCTTTCTTTGGACCGGGGAACCACCGCTGGGAACGATCCACACCAAAAAACCTTGGGATTTGTTGGGTTTTCCAGCGTTTGGGTTTCCCAG
Full Trace Sequence: CGGACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGGCGTGGTTTGATACGAAGAGGGATTCTCCTGCAGCAGCTCCTGCATCTCCGCTGGCTACATATTTTCCTTGGCACGCCAGGCTGTTGGCCAGGGCGCGCTTGATGTACTCATCCTGAGCCTTCTTGGTGTTCTCCTTCTTGCCCCCCCAAGCTTTGAGGGCAGAGGCCTGAAGGGCACGTCCGTAGGAGAAGGTCAGGGGCCAGGGTTTGAGCAGGGGGCACTGGTTGATGGCATTCAGGTGCACCGTGGCCTCTTCCTCACTTTGTCCTCCAGACAGGAAGGTGATTCCTGCAACAGCAGGGGGCACTGTGCGCCTGAGGGCGGTGACTGTTGCCATGGCAATCTCCTGAGGGGGGTACTTCTTGGTGCAGGCGTGCCCGGGGGTAACCATGTTTGGTTTCAGCAGGGTCCCTTCCAGGTAAACGTGATGGTCGCTGAGAGCCTTGTAGACTGCAGCCAGAACCTTCTCTGTCACGTACTGGCACCTCTTCAGGTCATGTTCTCCATCANGAAGGACCTCGGGCTCCACAATGGGCACAATTCCATTCTGTTGGCAGATGCTGGCGTAACGGGGCAATACGTTGGCATTCTCTATGATGGCCAGGTGAGAGGGGGGTGTGTTCAGAGATCTTGAGCACGGAGCGCCCCTTGGCAAAGTCAGCCGCCATCTTTCTTTGGACCGGGGAACCACCGCTGGGAACGATCCACACCAAAAAACCTTGGGATTTGTTGGGTTTTCCAGCGTTTGGGTTTCCCAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGGCGTGGTTTGATACGA