ORFeome > alg1 ORF1 – XORFeome v1.0

alg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: alg1
Gene ID: 1006367
Gene Page ID: 1006361
ORF Xenbase ID: 17263881

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130193
Original XGC clone length: 1458

Human orthology & disease relationships

NCBI Entrez ID: 56052
Ensembl gene IDs: ENSG00000033011
Directly associated (OMIM) disease MIM numbers: 608540
Indirectly associated (Lage, et al.) disease MIM numbers: 607906,608093,608540,608799

Library Location

Plate ID: GDExl11085
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ837776
dbEST ID: 79655478
Trimmed Sequence: ATGGCGTGTGTTAGGAAGCTCATATTGCTTGCGGTAGTTTTGTCCTGTGGCACTGCGGCTTTATGCGGTGCTAGTTTTTTAAACTACATACTGTTCCTCTGTGTGCTGCCCGCGCTATTGCTTGCTTGGACTGATAATCCGAAAGGTAACAAGCGGATTTGCGTGCTTGTTCTTGGAGACATCGGCCGTAGCCCGCGGATGACGTATCACGCGCTGTCATTGGCTCGGCATGGGTTTTTTGTGACCCTTGCAGGCTTCCGTGAATCTGAACCCCATAGAGAGCTCTTACATCATGAAAGAATAAATATTCAGCCAATTTCTGAATTTAGAATGTTTAAAGTTGGCCCACGGATGTTTCAGTACTTTGTTAAGGTGATTGTTCAGGCTTTTCAGCTTTTTTACATATTACTGAAGATTGATCCCCTTTCATATATCATTCTTCAGAATCCTCCAGGCTTGCCTAGTATTGCAGTTACGTGGTTGTTTTGTGTTCTAAGAAGGAGCCAACTCATAATTGACTGGCATAACTATGGCTATTCAATCATGAGCCTGACAAATGGACCAAAGCATCCAATTGTGCGAATTGCAAAATGGTATGAATATGTGATTTGGGCGTCTGTCTGATTATAACTTTTGTGTGACTAATGCAATGAAAGATGACTTAATGATTAACTGGAACATCAAAGCTGCTACTCTCTATGATAAACCTGCC
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTGTGTTAGGAAGCTCATATTGCTTGCGGTAGTTTTGTCCTGTGGCACTGCGGCTTTATGCGGTGCTAGTTTTTTAAACTACATACTGTTCCTCTGTGTGCTGCCCGCGCTATTGCTTGCTTGGACTGATAATCCGAAAGGTAACAAGCGGATTTGCGTGCTTGTTCTTGGAGACATCGGCCGTAGCCCGCGGATGACGTATCACGCGCTGTCATTGGCTCGGCATGGGTTTTTTGTGACCCTTGCAGGCTTCCGTGAATCTGAACCCCATAGAGAGCTCTTACATCATGAAAGAATAAATATTCAGCCAATTTCTGAATTTAGAATGTTTAAAGTTGGCCCACGGATGTTTCAGTACTTTGTTAAGGTGATTGTTCAGGCTTTTCAGCTTTTTTACATATTACTGAAGATTGATCCCCTTTCATATATCATTCTTCAGAATCCTCCAGGCTTGCCTAGTATTGCAGTTACGTGGTTGTTTTGTGTTCTAAGAAGGAGCCAACTCATAATTGACTGGCATAACTATGGCTATTCAATCATGAGCCTGACAAATGGACCAAAGCATCCAATTGTGCGAATTGCAAAATGGTATGAATATGTGATTTGGGCGTCTGTCTGATTATAACTTTTGTGTGACTAATGCAATGAAAGATGACTTAATGATTAACTGGAACATCAAAGCTGCTACTCTCTATGATAAACCTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTGTGTTAGGAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837775
dbEST ID: 79655477
Trimmed Sequence: AGTTTTACAGTTTTCTGTGATCAGCGGTAGAACAATCTGGTCCCAGGATTCATCCCAGCGTATTTGTACAGATTCACTGAGATTATGTCGAAATCTATTAAGTTTGCTTGACTTACTCGTAAAATCCGTAAACATATCCTTTAATTGTTCAGCAAGCTCTAGTGCATCTTCAAATATTAAACCATTTTCTTCATGTTTTACAAGTTCATGTAAACATTTAAATTTAATTGCACAAACAGGAAGACAGCAACCAAACATATCCACCACTTTCATTGGAAGGTCCAGGCCACTGGATGACTTGTGGAGACACACTCCCAGATCAGCCGATCCCAATAAAAGTGGATAATCTTCTGCCTCCAACCATGGTGTGCAAATCTGGATGTTCTTAAACTGCATCTCTTTAATTAGCCGACTGTAGTGTTCCTTTAAAGGCCCCTTTCCTGTTATAACACAAACAAGTGATGGAAGTTTGGCTCCATTTCGAATATACAATTCATACTCTTCCAGTGCTTTCAGTAATACTGAAAAGTCTTCATCCTCTGTCCAGCTTGTACTACTGATTAATAATGCAGGGCGCTCCTTGTTGTAGTTAACAGCACCATTTTCCAGGGTTAAATCAGTGAAAGCAGTTTTTTCAGTGCCTGAGCATTTAGATTGTGACTGATATCTAAATGGTGGATACTCCTTTGCAAGATTCATGAATAATTTGTGCTGCATTTCAATCCGAGTTTCTCGAAAAATGGAGGCAGGCTTATCAAAGAGAGTAGCAACTTTTATGTTCCAGTTAACCATTAAGTCATCCTTCAATGCATTAATCACACAAAAGTTATAATCAGACAGACGCCCCAACACATATTCATACAATTTTGCAATTCTCACAATTGGATGCTTTTGTCCATTTGTAAGGCTCATGATTGAATACCAAAATTTATCCAATCAATTAAGAAATTGGTTCCTTCTTTAAAAACAAAAAACAACATAAACTGCATAATAAGGCCAACCCGGGGAGAATTCTAAAAAAAAAAAATTTTAAAAAGGGAAAAAATCCCTCTCCAAAAAAGATTAAAAAAAACCTGAAAAAACCGGAAACAAAACCCACCTTAACAAAAAAATACACTAAAAAAACACCCCGGGGTGGGCCGCAACATCTTTTGAAACACACTTTCTAAATATTTTCTCAATAAATAAAAT
Full Trace Sequence: GGGCAGAGAAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTTTTACAGTTTTCTGTGATCAGCGGTAGAACAATCTGGTCCCAGGATTCATCCCAGCGTATTTGTACAGATTCACTGAGATTATGTCGAAATCTATTAAGTTTGCTTGACTTACTCGTAAAATCCGTAAACATATCCTTTAATTGTTCAGCAAGCTCTAGTGCATCTTCAAATATTAAACCATTTTCTTCATGTTTTACAAGTTCATGTAAACATTTAAATTTAATTGCACAAACAGGAAGACAGCAACCAAACATATCCACCACTTTCATTGGAAGGTCCAGGCCACTGGATGACTTGTGGAGACACACTCCCAGATCAGCCGATCCCAATAAAAGTGGATAATCTTCTGCCTCCAACCATGGTGTGCAAATCTGGATGTTCTTAAACTGCATCTCTTTAATTAGCCGACTGTAGTGTTCCTTTAAAGGCCCCTTTCCTGTTATAACACAAACAAGTGATGGAAGTTTGGCTCCATTTCGAATATACAATTCATACTCTTCCAGTGCTTTCAGTAATACTGAAAAGTCTTCATCCTCTGTCCAGCTTGTACTACTGATTAATAATGCAGGGCGCTCCTTGTTGTAGTTAACAGCACCATTTTCCAGGGTTAAATCAGTGAAAGCAGTTTTTTCAGTGCCTGAGCATTTAGATTGTGACTGATATCTAAATGGTGGATACTCCTTTGCAAGATTCATGAATAATTTGTGCTGCATTTCAATCCGAGTTTCTCGAAAAATGGAGGCAGGCTTATCAAAGAGAGTAGCAACTTTTATGTTCCAGTTAACCATTAAGTCATCCTTCAATGCATTAATCACACAAAAGTTATAATCAGACAGACGCCCCAACACATATTCATACAATTTTGCAATTCTCACAATTGGATGCTTTTGTCCATTTGTAAGGCTCATGATTGAATACCAAAATTTATCCAATCAATTAAGAAATTGGTTCCTTCTTTAAAAACAAAAAACAACATAAACTGCATAATAAGGCCAACCCGGGGAGAATTCTAAAAAAAAAAAATTTTAAAAAGGGAAAAAATCCCTCTCCAAAAAAGATTAAAAAAAACCTGAAAAAACCGGAAACAAAACCCACCTTAACAAAAAAATACACTAAAAAAACACCCCGGGGTGGGCCGCAACATCTTTTGAAACACACTTTCTAAATATTTTCTCAATAAATAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTTTTACAGTTTTCTGTGATCAG