ORFeome > alg11 ORF1 – XORFeome v1.0

alg11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: alg11
Gene ID: 5934162
Gene Page ID: 5934130
ORF Xenbase ID: 17263893

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124907
Original XGC clone length: 1260

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ837537
dbEST ID: 79655239
Trimmed Sequence: ATGGCAGGGCCGATGTGCTTATGTGGGATGATGAGGCTGTTGACTGCCTTGTTCATCCCAGTGCTGATTACCCGCCTTGGTTTTGTGCCTCATCTTTGTCTTGCTTTTTATTTGCACTCGATTGTGGGTTCAGCGAAAGAAAAAGGTGGAAATAGGAAAAGATGGGAAAAAGAAGAAAGTGGTGGCGTTTTTTCACCCATACTGCAATGCTGGAGGCGGAGGACAGAGAGTACTGTGGTGTGCATTGAGATCCCTCCACAAGAGGTACAAAGATGCGATCTACGTCATTTATACTGGTGATAAAGATGCCTCTGACGAACATATCCTTAACTTGGCTGCTCCAAGATTTGACATCAAGCTGTCCCACCCCGTGGGGTTCGTTTTCCTGGAGGAGCGTGGACTTGTAGAAGCAACCTGTTGCCCCCCTTTTACTTTGCTGGGGCTGAGTCTTGGCTCCGTTGTTTTCGGCTGGCGGGGGGGGGGGAATTACATGCCGGAGGGGGGCATTCTTTCTCTGGGCTCGGGGGGTGGTTGCATCTCGGCCTTTATCTTCTCCGAGGCGACGCTCCCCGCGCGGCCCCCCCCCCCAACATCCGAAAGGGAAAGGAGGAAATATCTTCTCTGTCGGCCCCCCCCAATCAGGTATGTAGACTATGAGTCTGTTTTTTCTTATTCTTTTCTGTCCCCCCCCGCAAAGGAAAATAATTTTTTTTTTTTCTCTTGGGGTAGATAGGGGGGGGGGGGGGGGGCCCCCCCCGCGCCGCCGCCCAAGGGAGGGGGGGGCCGGTCGGTTGTCCTCTCTCCCCCCCC
Full Trace Sequence: GGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGCCGATGTGCTTATGTGGGATGATGAGGCTGTTGACTGCCTTGTTCATCCCAGTGCTGATTACCCGCCTTGGTTTTGTGCCTCATCTTTGTCTTGCTTTTTATTTGCACTCGATTGTGGGTTCAGCGAAAGAAAAAGGTGGAAATAGGAAAAGATGGGAAAAAGAAGAAAGTGGTGGCGTTTTTTCACCCATACTGCAATGCTGGAGGCGGAGGACAGAGAGTACTGTGGTGTGCATTGAGATCCCTCCACAAGAGGTACAAAGATGCGATCTACGTCATTTATACTGGTGATAAAGATGCCTCTGACGAACATATCCTTAACTTGGCTGCTCCAAGATTTGACATCAAGCTGTCCCACCCCGTGGGGTTCGTTTTCCTGGAGGAGCGTGGACTTGTAGAAGCAACCTGTTGCCCCCCTTTTACTTTGCTGGGGCTGAGTCTTGGCTCCGTTGTTTTCGGCTGGCGGGGGGGGGGGAATTACATGCCGGAGGGGGGCATTCTTTCTCTGGGCTCGGGGGGTGGTTGCATCTCGGCCTTTATCTTCTCCGAGGCGACGCTCCCCGCGCGGCCCCCCCCCCCAACATCCGAAAGGGAAAGGAGGAAATATCTTCTCTGTCGGCCCCCCCCAATCAGGTATGTAGACTATGAGTCTGTTTTTTCTTATTCTTTTCTGTCCCCCCCCGCAAAGGAAAATAATTTTTTTTTTTTCTCTTGGGGTAGATAGGGGGGGGGGGGGGGGGCCCCCCCCGCGCCGCCGCCCAAGGGAGGGGGGGGCCGGTCGGTTGTCCTCTCTCCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGGCCGATGTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837536
dbEST ID: 79655238
Trimmed Sequence: GGCGTCCATTAGTAGAATATTAATGGACGCTATAATATGTTTACAGAACAAAATGGCTAAACTCTCACCAATTCCAAAGTGCTCGTTCCACATGGTGTGCAAGCCAATGGTAGCTTCACTTAAATGCTTCTTTAGCTCCTCAAATGGAACGTTTACTTTGAACTCCACAGGAATTCCGAGTTCTGAGCTGAGTTTTTTCAGCTCTGACACACGGAGCTCATCTTCATCGTTGCGACACCCTCCAATTAGGATCAGTTTCAGCTTTGCTCTTTGTTCAGCGGTTTTCTTCTCCAGCAAGGCTGCAAATGCGCGTATTTGCAAAGGGTGGTCCTTCTCAGGCCTGAACTGCCCTATAGAAACAACTGAATGCTCCTCGTTTTCTTTGTGTTGGTTTATATCGATCTCTAAAAATGTCTGAACATCACATGGGGGATAAACTATACTAGTACGGTCACTACATTTCCACAGGTCAAGGATGTGGGAGAAAGTCCATGTTGAGTTCACCATGATGACGTCACTACATGAACCAACCCATCCCTAGAATAGTGCAAACAGATGATAATAAATCAGTTTCAGTCTGCTTAGAACAGGATTGTTAGAGATTAAAGCAGCATTGTTGAATCTTTGCTGCTGACTGGCCCACACCAAAAGCAAATCCATCCTTAATATCGGAAAAGGCACATAGCCAGCCAACATGGCCACCCTCCCAGGAAACTTGAAAAAAAGGCAATGGTAAATGGCTTAACCCCAAAAAAACCAATGAAAAATTTCCC
Full Trace Sequence: CGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCGTCCATTAGTAGAATATTAATGGACGCTATAATATGTTTACAGAACAAAATGGCTAAACTCTCACCAATTCCAAAGTGCTCGTTCCACATGGTGTGCAAGCCAATGGTAGCTTCACTTAAATGCTTCTTTAGCTCCTCAAATGGAACGTTTACTTTGAACTCCACAGGAATTCCGAGTTCTGAGCTGAGTTTTTTCAGCTCTGACACACGGAGCTCATCTTCATCGTTGCGACACCCTCCAATTAGGATCAGTTTCAGCTTTGCTCTTTGTTCAGCGGTTTTCTTCTCCAGCAAGGCTGCAAATGCGCGTATTTGCAAAGGGTGGTCCTTCTCAGGCCTGAACTGCCCTATAGAAACAACTGAATGCTCCTCGTTTTCTTTGTGTTGGTTTATATCGATCTCTAAAAATGTCTGAACATCACATGGGGGATAAACTATACTAGTACGGTCACTACATTTCCACAGGTCAAGGATGTGGGAGAAAGTCCATGTTGAGTTCACCATGATGACGTCACTACATGAACCAACCCATCCCTAGAATAGTGCAAACAGATGATAATAAATCAGTTTCAGTCTGCTTAGAACAGGATTGTTAGAGATTAAAGCAGCATTGTTGAATCTTTGCTGCTGACTGGCCCACACCAAAAGCAAATCCATCCTTAATATCGGAAAAGGCACATAGCCAGCCAACATGGCCACCCTCCCAGGAAACTTGAAAAAAAGGCAATGGTAAATGGCTTAACCCCAAAAAAACCAATGAAAAATTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCGTCCATTAGTAGAATATTAAT