ORFeome > alpi.1 ORF1 – XORFeome v1.0

alpi.1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: alpi.1
Gene ID: 866568
Gene Page ID: 854725
ORF Xenbase ID: 17263965

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129591
Original XGC clone length: 1593

Human orthology & disease relationships

NCBI Entrez ID: 248
Ensembl gene IDs: ENSG00000163295
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 139300,140350,146300,200950,203500,214150,216400,222900,241500,241510,264600,270200,276710,307030,601675,602433,606002,608643

Library Location

Plate ID: GDExl11086
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ837801
dbEST ID: 79655503
Trimmed Sequence: ATGGGATACCTTGTGTGCCTGAGCTGGTTGCTTCTCTGGCTTTGCACAGCTAGGACCCAATATGCCACTATTCCAGAGGAAGAGAACAAAGCTGAATTTTGGAACAGCAAAATGATATCCAGGATTGATGAAGCCCTAAAGCTAAAGCCCATTAAGCACAGAGCTAAGAACCTGATACTCTTCTTAGGTGATGGAATGGGGGTTCCAACAGTCACTGCCACCAGAATCTTAAGTGGTCAGATGAAGAGCATGCTGGGAGAAGAGAATGAGCTGGCAATGGACAAGTTCCCCTACATTGCACTTTCTAAGACGTACAATGTGGATCGGCAGGTTCCTGACAGCGCTGGTACAGCCACTGCTTATCTCTGTGGAGTGAAAGGCAACTATGGAACAGTCGGAGTGACTGCAGCTGTCAAACGTTCTAACTGCAGCAATATCAAAGGCAATGAGGTTGAATCGGTTCTCAAGAAAGCAAAGGCCGCAGGAAAATCTGTAGGAATTGTCACTACAACACGAGTCCAGCACGCTTCCCCTTCCGGCACTTATGCTAACACTCCTGATCGGAATTGGTACAGTGATGGCGACATGCCCGCAGATGCTGTAGAGGCTGGCTGTAAAGATATTGCCCATCAGCTGATTTCAAACGTGGACATTGATGTCATTCTTGGGAAGTTGGGCGAAAATATATGAACTCCAGTGGGGAACACCTTGATCCTGAAATACCCCTGCAGACAGCCAGCCAAAATGGGTAAAAAAAAAAAAATGGGGAAGAAAACCCTTTTAAAAAAAAAATAGGCTTTCAAAAAAAAACCAAG
Full Trace Sequence: TCGAGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATACCTTGTGTGCCTGAGCTGGTTGCTTCTCTGGCTTTGCACAGCTAGGACCCAATATGCCACTATTCCAGAGGAAGAGAACAAAGCTGAATTTTGGAACAGCAAAATGATATCCAGGATTGATGAAGCCCTAAAGCTAAAGCCCATTAAGCACAGAGCTAAGAACCTGATACTCTTCTTAGGTGATGGAATGGGGGTTCCAACAGTCACTGCCACCAGAATCTTAAGTGGTCAGATGAAGAGCATGCTGGGAGAAGAGAATGAGCTGGCAATGGACAAGTTCCCCTACATTGCACTTTCTAAGACGTACAATGTGGATCGGCAGGTTCCTGACAGCGCTGGTACAGCCACTGCTTATCTCTGTGGAGTGAAAGGCAACTATGGAACAGTCGGAGTGACTGCAGCTGTCAAACGTTCTAACTGCAGCAATATCAAAGGCAATGAGGTTGAATCGGTTCTCAAGAAAGCAAAGGCCGCAGGAAAATCTGTAGGAATTGTCACTACAACACGAGTCCAGCACGCTTCCCCTTCCGGCACTTATGCTAACACTCCTGATCGGAATTGGTACAGTGATGGCGACATGCCCGCAGATGCTGTAGAGGCTGGCTGTAAAGATATTGCCCATCAGCTGATTTCAAACGTGGACATTGATGTCATTCTTGGGAAGTTGGGCGAAAATATATGAACTCCAGTGGGGAACACCTTGATCCTGAAATACCCCTGCAGACAGCCAGCCAAAATGGGTAAAAAAAAAAAAATGGGGAAGAAAACCCTTTTAAAAAAAAAATAGGCTTTCAAAAAAAAACCAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATACCTTGTGTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ837800
dbEST ID: 79655502
Trimmed Sequence: AAATATGAAACCAACATGTATGGCAGAAATGAGCAGCCAGAGAGCAGGCATCAGAAGCAGAGCAGCACTTGCTTTGGTTGTGGAAGCATTATTGTTTTGGGAAGGACAGTCTTTGTAGGAAGGCAAACAAGCTGCATATGCCATGACATGGGCTACATATGTCTGCTCCTGGACTCCATGAAATAAATGTGACATAGGCCCCTTTGAGAATATGGCCACGTCTTCTCCACCATGAGTTTCAGAATCCAAGGGTACTGCCGCCTGCTGCATATAGTTAACGTCCTCGCTCAGATTGCTATTCACATTTGGTCGTCCTTGGTCAGTTCTGTTGAACCCAGGCCCATTACCATAAAGAATGGACGTGTAATACTTGTTGTCAAAAGCCTTCTTAGGAGCCAGACCAAATATGCTGCTTCCTCTATAAGTATAGCCCCCAAAGCTGAAGACATGGGAATGGTCAGCAGTCACCACAGTCAGCGTATCTATTTCATTGGTTAGTTGATCTGCTTTATCGATAGCCCTGTCAAACATCACTCCCTCAGTTAGTGCCTGTTTGGCTTTTCCATCGTGATGCCCATGGTCTATCCTTCCACCTTCAACAAAGAGGTAAAATCCCTGGGGGTTCCTCTGTAGGAGACGGATAGCTATTTCCTTTACTCCCCAATGGATGGGTCAGTGGTAGAATTGCGGTTTCACTCAATTTCAAATCTGATGGCTCAAACGAACCCACACATGTGTTGCGGAGGAGACATCAATTTTATCCATTTGTTCTTTTGTTCCCACAATAAAGAACCTCCTTGGTTTTCTTAAGCCATTCTGCAGAAAGGTCTTTCCGAGCTTTTCTTAAAACCATTTTGCTTGCTTGTCTGGCGGGGAACTCGGGAAGGGGGGTGTCCGGCTGGAGGTCATATTTTTGCGCCGAACCTCCGGAAAAACAACCAAGGGACAGGTTTGGAGGGGGGGGGAGGGGGGAAAAGTTGTAAGGGGCGACCTCCCCAGCATTTGTGGGGGGGAGTGGCGGGGGGGGGGGGGACGGTTCGAACAAGAAGATGGATGTAAAAAGAAGGCGGGAAAAGGAGAAAAAACAGGTGGGGGGGAGGAGGGGGGGGGAGGGGGGGGACGACATCTCCCATACAGAATATTTTTCCTGTGGCGGGGGCCCTTGTGTGTGTTTTGTTGATGAAGGGAAAGAGACGGGCGAAGATGACAGCTC
Full Trace Sequence: CGGCCGGGAAACAGGCTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAATATGAAACCAACATGTATGGCAGAAATGAGCAGCCAGAGAGCAGGCATCAGAAGCAGAGCAGCACTTGCTTTGGTTGTGGAAGCATTATTGTTTTGGGAAGGACAGTCTTTGTAGGAAGGCAAACAAGCTGCATATGCCATGACATGGGCTACATATGTCTGCTCCTGGACTCCATGAAATAAATGTGACATAGGCCCCTTTGAGAATATGGCCACGTCTTCTCCACCATGAGTTTCAGAATCCAAGGGTACTGCCGCCTGCTGCATATAGTTAACGTCCTCGCTCAGATTGCTATTCACATTTGGTCGTCCTTGGTCAGTTCTGTTGAACCCAGGCCCATTACCATAAAGAATGGACGTGTAATACTTGTTGTCAAAAGCCTTCTTAGGAGCCAGACCAAATATGCTGCTTCCTCTATAAGTATAGCCCCCAAAGCTGAAGACATGGGAATGGTCAGCAGTCACCACAGTCAGCGTATCTATTTCATTGGTTAGTTGATCTGCTTTATCGATAGCCCTGTCAAACATCACTCCCTCAGTTAGTGCCTGTTTGGCTTTTCCATCGTGATGCCCATGGTCTATCCTTCCACCTTCAACAAAGAGGTAAAATCCCTGGGGGTTCCTCTGTAGGAGACGGATAGCTATTTCCTTTACTCCCCAATGGATGGGTCAGTGGTAGAATTGCGGTTTCACTCAATTTCAAATCTGATGGCTCAAACGAACCCACACATGTGTTGCGGAGGAGACATCAATTTTATCCATTTGTTCTTTTGTTCCCACAATAAAGAACCTCCTTGGTTTTCTTAAGCCATTCTGCAGAAAGGTCTTTCCGAGCTTTTCTTAAAACCATTTTGCTTGCTTGTCTGGCGGGGAACTCGGGAAGGGGGGTGTCCGGCTGGAGGTCATATTTTTGCGCCGAACCTCCGGAAAAACAACCAAGGGACAGGTTTGGAGGGGGGGGGAGGGGGGAAAAGTTGTAAGGGGCGACCTCCCCAGCATTTGTGGGGGGGAGTGGCGGGGGGGGGGGGGACGGTTCGAACAAGAAGATGGATGTAAAAAGAAGGCGGGAAAAGGAGAAAAAACAGGTGGGGGGGAGGAGGGGGGGGGAGGGGGGGGACGACATCTCCCATACAGAATATTTTTCCTGTGGCGGGGGCCCTTGTGTGTGTTTTGTTGATGAAGGGAAAGAGACGGGCGAAGATGACAGCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATATGAAACCAACATGTATGGC