ORFeome > alpl ORF1 – XORFeome v1.0

alpl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: alpl
Gene ID: 1010304
Gene Page ID: 1010300
ORF Xenbase ID: 17263971

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043760
Original XGC clone length: 1581

Human orthology & disease relationships

NCBI Entrez ID: 249
Ensembl gene IDs: ENSG00000162551
Directly associated (OMIM) disease MIM numbers: 146300,241500,241510
Indirectly associated (Lage, et al.) disease MIM numbers: 139300,140350,146300,200950,203500,214150,216400,222900,241500,241510,264600,270200,276710,307030,601675,602433,606002,608643

Library Location

Plate ID: GDExl11010
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ823796
dbEST ID: 79641498
Trimmed Sequence: ATGGTGAAACTGTGGCTGTTGCTCCTGCTGGGGACCCTCTCCGAGTCGGTCACATTTCCAGAACAAGAGAAAAACCCAAATTACTGGAGGCGACAGGCCCAGGAGACGCTGATGAACGCGCTGCAGCTGCAAAACCTCAATACCAACGTTGCAAAGAATGTCATCATGTTCCTGGGTGATGGTATGGGGGTGCCCACAGTAACTGCCGCCAGGATTCTCAAAGGGCAACTGGCTGGGCAGCCGGGGGAAGAGACGCAGCTTGAAATGGACAAGTTTCCCCACGTTGCTCTTTCTAAGACCTACAACACCAACGCTCAGGTGCCAGACAGCGCGGGCACAGCCACTGCCTATCTGTGTGGGGTGAAAGCCAACGAGGGCACCGTGGGGGTCAATGCCGCTGCTGTGAGGAATCAGTGTAACACCAGCAAGGGCAACGAGGTGGACTCCATCATGAAATGGGCCAAGCAAGCAGGGAAATCCGTAGGGGTAGTAACTACAACGCGGATTAATCATGCCACCCCCAGCGCAGCCTATGCCCACTGTGTGAATAGAGACTGGTACTCTGACCAAGAGATGCCCAAGGAGGCCGTGGAACAGGGGTGCAAAGACATTGCCTGGCAACTCATGAACAACATCCCAAATATTGAGGTAATTATGGGGAGGGGGGAAGGAAATACATGTTCCCTANNAACACTTTCTGATGTGGAGTACCCCCACGATGACNNAGTCAGCGGCACCCCGATTGGATGGACGTGAACCTGACCCAAAATCTGGGCTGGAACCCAAAACCCAATAAAAAGGGCGGGCTCGCCTTTGTTTTGGGAAACCCGGGAAAAAAAT
Full Trace Sequence: TATTGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAAACTGTGGCTGTTGCTCCTGCTGGGGACCCTCTCCGAGTCGGTCACATTTCCAGAACAAGAGAAAAACCCAAATTACTGGAGGCGACAGGCCCAGGAGACGCTGATGAACGCGCTGCAGCTGCAAAACCTCAATACCAACGTTGCAAAGAATGTCATCATGTTCCTGGGTGATGGTATGGGGGTGCCCACAGTAACTGCCGCCAGGATTCTCAAAGGGCAACTGGCTGGGCAGCCGGGGGAAGAGACGCAGCTTGAAATGGACAAGTTTCCCCACGTTGCTCTTTCTAAGACCTACAACACCAACGCTCAGGTGCCAGACAGCGCGGGCACAGCCACTGCCTATCTGTGTGGGGTGAAAGCCAACGAGGGCACCGTGGGGGTCAATGCCGCTGCTGTGAGGAATCAGTGTAACACCAGCAAGGGCAACGAGGTGGACTCCATCATGAAATGGGCCAAGCAAGCAGGGAAATCCGTAGGGGTAGTAACTACAACGCGGATTAATCATGCCACCCCCAGCGCAGCCTATGCCCACTGTGTGAATAGAGACTGGTACTCTGACCAAGAGATGCCCAAGGAGGCCGTGGAACAGGGGTGCAAAGACATTGCCTGGCAACTCATGAACAACATCCCAAATATTGAGGTAATTATGGGGAGGGGGGAAGGAAATACATGTTCCCTANNAACACTTTCTGATGTGGAGTACCCCCACGATGACNNAGTCAGCGGCACCCCGATTGGATGGACGTGAACCTGACCCAAAATCTGGGCTGGAACCCAAAACCCAATAAAAAGGGCGGGCTCGCCTTTGTTTTGGGAAACCCGGGAAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAAACTGTGGCTGTTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829106
dbEST ID: 79646808
Trimmed Sequence: ATAGAAGAGCTGGAGGGAGAAGAGGGGCAGCAGAACAGAGACGAGAATCAGAGAAGTTCTGGCGCCGTTGTTTCCTTTGCCGGACGTACAGTGGTCCTGGTTCTGCCCAATACACGAGGCATAAGCCATTACATGGGGGATATAGTTCTGTTCATGGACTCCATGCAGCAGGTGGGCCATCGGGCCCTTGGCAAACACAGCCACGTCCTCCCCCCCGTGGGTCTCCATGCGCAGGGGAACCGCCGACTGGGCCAAGTAGTTGGGGTGAGAAAAATCCACAGTGGAGACGTTCTCCCTTTGCCCGTTGACCAGTTTGTAGCCTGGGCCGTTCCCGTAGAGGATGGAAGTGAAAGGTTTTTGGTCCACGTCACTGGGAACTGGAGCCAAACCAAAGATTGGGTTTCCTCTATGAGTGTAACCTCCGAAGGTGAAGACGTGGGAGTGATCGGCGGTGACCACTGTGAGGGTGTCTTCTACTGAAGTCATGTTCCCTGATACTCCAATAGCGATGTCCATTTGTACAGCCTCGTGCAGCGCTTGGTTTGCCTTCCCCTCGTGGTGTCCGTGGTCTATTCTTCCACCTTCTANCAGGAGAAAGAATCCCATTGGGTTATTCCCCAATATTTTGATTGCCCGCTTCACCATTTCTGACNGAGAGGGGTCCATGGTCGTATTTCTTCTCCAGGTCATAGAGCATGTCCACCGGCCTCGAACAAACCGAGCAGAATAAACCACCTTCTTTGGGGATTTCCAAAAACCAAAAGT
Full Trace Sequence: CGTGTAAACCGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAGAAGAGCTGGAGGGAGAAGAGGGGCAGCAGAACAGAGACGAGAATCAGAGAAGTTCTGGCGCCGTTGTTTCCTTTGCCGGACGTACAGTGGTCCTGGTTCTGCCCAATACACGAGGCATAAGCCATTACATGGGGGATATAGTTCTGTTCATGGACTCCATGCAGCAGGTGGGCCATCGGGCCCTTGGCAAACACAGCCACGTCCTCCCCCCCGTGGGTCTCCATGCGCAGGGGAACCGCCGACTGGGCCAAGTAGTTGGGGTGAGAAAAATCCACAGTGGAGACGTTCTCCCTTTGCCCGTTGACCAGTTTGTAGCCTGGGCCGTTCCCGTAGAGGATGGAAGTGAAAGGTTTTTGGTCCACGTCACTGGGAACTGGAGCCAAACCAAAGATTGGGTTTCCTCTATGAGTGTAACCTCCGAAGGTGAAGACGTGGGAGTGATCGGCGGTGACCACTGTGAGGGTGTCTTCTACTGAAGTCATGTTCCCTGATACTCCAATAGCGATGTCCATTTGTACAGCCTCGTGCAGCGCTTGGTTTGCCTTCCCCTCGTGGTGTCCGTGGTCTATTCTTCCACCTTCTANCAGGAGAAAGAATCCCATTGGGTTATTCCCCAATATTTTGATTGCCCGCTTCACCATTTCTGACNGAGAGGGGTCCATGGTCGTATTTCTTCTCCAGGTCATAGAGCATGTCCACCGGCCTCGAACAAACCGAGCAGAATAAACCACCTTCTTTGGGGATTTCCAAAAACCAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAGAAGAGCTGGAGGGA