ORFeome > ambp ORF1 – XORFeome v1.0

ambp ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ambp
Gene ID: 5747560
Gene Page ID: 5747471
ORF Xenbase ID: 17263989

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054142
Original XGC clone length: 1029

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ839529
dbEST ID: 79657231
Trimmed Sequence: ATGAACACCTGCTGGGCCCTAATTTTGGTCCCCGCACTCCTGGCTCTTGGGAGGTGCAGCCCAATCCAGCCAGAGGACAATATCCAGATCCAGGAGAACTTTGATCTCCAGAAGATTTATGGCAAATGGTACGACATTGCCATCGGCTCCACCTGCAAATGGCTGAAGCACCACAAGGAAAAGTTCAACATGGGGACACTGGAGCTTAGCGATGGGGAGACCGACGGGGAGGTGCGGATTGTGAACACAAGGATGAGGCACGGAACCTGCTCTCAGATTGTTGGGTCCTATCAGAAGACAGAGACCCCAGGGAAGTTCGACTATTTCAACGCACGGTGGGGAACCACGATCCAAAACTACATTGTCTTCACTAACTACAATGAGTATGTCATCATGCAGATGAGGAAGAAGAAGGGATCGGAGACCACAACGACCGTCAAGCTGTATGGGCGGAGCCCAGACTTGCGTCCGACCCTCGTTGATGAATTCAGGCAGTTTGCCTTGGCTCAGGGCATTCCTGAAGACTCCATCGTGATGCTACCTAACAATGGTGAGTGCTCTCCAGGGGAGATAGAAGTGAGACCACGGAGAACTCAGAGGGCGGTCCTTCCTGAGGAAGAGGAGGGGTCTGGAATGGAGAACAGCCCCTTTTCCAAAACAAGGTAGAGTCCTGCAGGCTGGCCCCAGCATGGGGCCCTTGCTTGGGCAATCACAACCGCTACTTCTACAACTCCTCCACCATGGGCCTGCAAGACGTTTCAGTTATGGGGGCTGCCTTTGGGAACCACAACAACTTTCCATTCTCTAAAAAAAAAGTTTCC
Full Trace Sequence: CGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACACCTGCTGGGCCCTAATTTTGGTCCCCGCACTCCTGGCTCTTGGGAGGTGCAGCCCAATCCAGCCAGAGGACAATATCCAGATCCAGGAGAACTTTGATCTCCAGAAGATTTATGGCAAATGGTACGACATTGCCATCGGCTCCACCTGCAAATGGCTGAAGCACCACAAGGAAAAGTTCAACATGGGGACACTGGAGCTTAGCGATGGGGAGACCGACGGGGAGGTGCGGATTGTGAACACAAGGATGAGGCACGGAACCTGCTCTCAGATTGTTGGGTCCTATCAGAAGACAGAGACCCCAGGGAAGTTCGACTATTTCAACGCACGGTGGGGAACCACGATCCAAAACTACATTGTCTTCACTAACTACAATGAGTATGTCATCATGCAGATGAGGAAGAAGAAGGGATCGGAGACCACAACGACCGTCAAGCTGTATGGGCGGAGCCCAGACTTGCGTCCGACCCTCGTTGATGAATTCAGGCAGTTTGCCTTGGCTCAGGGCATTCCTGAAGACTCCATCGTGATGCTACCTAACAATGGTGAGTGCTCTCCAGGGGAGATAGAAGTGAGACCACGGAGAACTCAGAGGGCGGTCCTTCCTGAGGAAGAGGAGGGGTCTGGAATGGAGAACAGCCCCTTTTCCAAAACAAGGTAGAGTCCTGCAGGCTGGCCCCAGCATGGGGCCCTTGCTTGGGCAATCACAACCGCTACTTCTACAACTCCTCCACCATGGGCCTGCAAGACGTTTCAGTTATGGGGGCTGCCTTTGGGAACCACAACAACTTTCCATTCTCTAAAAAAAAAGTTTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACACCTGCTGGGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839528
dbEST ID: 79657230
Trimmed Sequence: CAGTAACTCTTCACTCACATCTTTCTGTACCCCGCAGTACTCCTTGCACTCCTTCTCCGTGTAGAACTGGTTCCCATTCCCCTGGCACCCGCCGTAGGAGAACGTCACGCACTTTCCTTGCGCCGCATCAAAGGCCCAATGTGTCTTGGCCGTCTTGCATGGGCCGGGGGTAATCGGCAAACGACAGGCAGCCTCTGTCCTGCAGGTTTGCAGACACTCTTTCTCAGAATGGAAGTTGTTGTTGTTCCCAAGGCAGCCGCCATACTGAAACGTCTCGCAGGCCATGGTGGAGGAGTTGTAGAAGTAGCGGTTGTGATTGCCCAAGCAAGGGCCCGATGCTGGGGCCAGCCTGCAGGACTCTACCTTGTTTTTGGAAAAGGGGCTGTTCTCCATTCCAGACCCCTCCTCTTCCTCAGGAAGGACCGCCCTCTGAGTTCTCCGTGGTCTCACTTCTATTTCCCCTGGAGAGCACTCACCATTGTTATGTAGCATCACGATGGAGTCTTCAGGAATGCCCTGAGCCAAGGCAACTGCCTAAATTATCAACAAGGGTCGGAAGCAAGTCGGGGCTCCGCGATCACGCTTTGACGGTCTTGTGGTCTCCATCCCTTTCTCGTCCTCATCGCATGAGGAAGTACTCAATTGAAGTAGTGAGGAAAAGGTAGTTTTGGATCGTGGGTTCGCGCCCGGGGTTTAAGATAGGTCGAGAATCCCCTGGGGATAGCTGCCGGTCGGGGAGGGAACAAAACAATTCTAAAAAA
Full Trace Sequence: AAGACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTAACTCTTCACTCACATCTTTCTGTACCCCGCAGTACTCCTTGCACTCCTTCTCCGTGTAGAACTGGTTCCCATTCCCCTGGCACCCGCCGTAGGAGAACGTCACGCACTTTCCTTGCGCCGCATCAAAGGCCCAATGTGTCTTGGCCGTCTTGCATGGGCCGGGGGTAATCGGCAAACGACAGGCAGCCTCTGTCCTGCAGGTTTGCAGACACTCTTTCTCAGAATGGAAGTTGTTGTTGTTCCCAAGGCAGCCGCCATACTGAAACGTCTCGCAGGCCATGGTGGAGGAGTTGTAGAAGTAGCGGTTGTGATTGCCCAAGCAAGGGCCCGATGCTGGGGCCAGCCTGCAGGACTCTACCTTGTTTTTGGAAAAGGGGCTGTTCTCCATTCCAGACCCCTCCTCTTCCTCAGGAAGGACCGCCCTCTGAGTTCTCCGTGGTCTCACTTCTATTTCCCCTGGAGAGCACTCACCATTGTTATGTAGCATCACGATGGAGTCTTCAGGAATGCCCTGAGCCAAGGCAACTGCCTAAATTATCAACAAGGGTCGGAAGCAAGTCGGGGCTCCGCGATCACGCTTTGACGGTCTTGTGGTCTCCATCCCTTTCTCGTCCTCATCGCATGAGGAAGTACTCAATTGAAGTAGTGAGGAAAAGGTAGTTTTGGATCGTGGGTTCGCGCCCGGGGTTTAAGATAGGTCGAGAATCCCCTGGGGATAGCTGCCGGTCGGGGAGGGAACAAAACAATTCTAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTAACTCTTCACTCACATC