ORFeome > amt ORF1 – XORFeome v1.0

amt ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: amt
Gene ID: 921605
Gene Page ID: 921597
ORF Xenbase ID: 17264031

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123373
Original XGC clone length: 1215

Human orthology & disease relationships

NCBI Entrez ID: 275
Ensembl gene IDs: ENSG00000145020,LRG_537
Directly associated (OMIM) disease MIM numbers: 605899
Indirectly associated (Lage, et al.) disease MIM numbers: 229100,236250,250940,259900,600794,601472,605899,606664,608688

Library Location

Plate ID: GDExl11084
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ837497
dbEST ID: 79655199
Trimmed Sequence: ATGCAGCGATTGCGCTGGATCGGTGTTAAAGCGCTGCGATCTGGGGCAGCTGGGAGTAGGTTGCAGGAGAGGAGCTACAGCAGCCACCCAGACCAATCCCCCTCGCCAGACACCACTGTACGACTTTCATCGTGAACATGGCGGCAAGATGGTGGAGTTTGCAGGCTGGAAGCTTCCAGTGCAGTACAAAGACTCACACATTGCCTCCCATCTCCACACCCGTCAACACTGTTCTGTGTTTGATGTTTCCCACATGCTGCAGACCAAAGTCCTAGGGAAGGATCGCATACCCTTCATGGAGAGCATGGTGGTGGCAGATATTGCAGAGCTAAAGGAGAACCAGGGTACATTGTCTCTCTTCACTAACGAGAAGGGTGGAATAATTGATGACCTCATAGTCACCAAGACCTCAGATGGATATCTATATGTGGTGTCCAATGCTGGCTGCTCTGAGAAGGACTCTGCCCACATGCTGAATAAATTGCAGGCGTTCAAAGCCGCTGGACGTGATGTGGATCTAGAACACATTGATTGTGCTCTTCTGGCAGTGCAAGGTCCCCTTTCTGCTCGAGTTCTCCAGGCTGGACTAACTGATGATCTTTCCGAGCTAACATTCATGACCAATGTTTACACAACTGTGTTTGGCATCCCTGGCTGCAGAATGACTCGCTGTGGATCACAGGAAAAGAATGGTGTGGAAATCTCTGTGCTAGCCCCGCCGGCCCAGGGAATTGGGCTTACAAGCCGCCTTCAAAACACGTGAAATTTAAAAATT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCGATTGCGCTGGATCGGTGTTAAAGCGCTGCGATCTGGGGCAGCTGGGAGTAGGTTGCAGGAGAGGAGCTACAGCAGCCACCCAGACCAATCCCCCTCGCCAGACACCACTGTACGACTTTCATCGTGAACATGGCGGCAAGATGGTGGAGTTTGCAGGCTGGAAGCTTCCAGTGCAGTACAAAGACTCACACATTGCCTCCCATCTCCACACCCGTCAACACTGTTCTGTGTTTGATGTTTCCCACATGCTGCAGACCAAAGTCCTAGGGAAGGATCGCATACCCTTCATGGAGAGCATGGTGGTGGCAGATATTGCAGAGCTAAAGGAGAACCAGGGTACATTGTCTCTCTTCACTAACGAGAAGGGTGGAATAATTGATGACCTCATAGTCACCAAGACCTCAGATGGATATCTATATGTGGTGTCCAATGCTGGCTGCTCTGAGAAGGACTCTGCCCACATGCTGAATAAATTGCAGGCGTTCAAAGCCGCTGGACGTGATGTGGATCTAGAACACATTGATTGTGCTCTTCTGGCAGTGCAAGGTCCCCTTTCTGCTCGAGTTCTCCAGGCTGGACTAACTGATGATCTTTCCGAGCTAACATTCATGACCAATGTTTACACAACTGTGTTTGGCATCCCTGGCTGCAGAATGACTCGCTGTGGATCACAGGAAAAGAATGGTGTGGAAATCTCTGTGCTAGCCCCGCCGGCCCAGGGAATTGGGCTTACAAGCCGCCTTCAAAACACGTGAAATTTAAAAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCGATTGCGCTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837496
dbEST ID: 79655198
Trimmed Sequence: CTTTAGGGTATAATACTTTGCAGGCACAAATGGCATTTTGGTGGTAACACCATCTACAATCTTCTTCCTGACTTCAAAACGCACGGCTGTGCCAGCTTTTGCGTATTCTGGTTCCACATAGCCCATGGCCACATTAACTCGCAGACTGGGCGAAGGGCAACCGCTGGTCACTTCACCAATAACACGCCCCTCTAGGTTCAGGATAGGCGCATGCTGCCGGACTGGAGGTCCTGTTGAGGTCAGACCAACTCGCTTATGTTTCACTTTTCCTTTAATCTGAGGGACAATGACCGAGGCTCCTGGAAAATCCATTGCTGTTCTGCGTCGTTTTCCAAGAGTCCAAACCAAGCTGGCTTCCACTGGAGTGGTGGTCTCATCAATGTCATTGCCATACAGACATAACCCAGCCTCCAGGCGCAAACTGTCACGTGCTGCCAGACCTGCCAACTTCACATCACTGTTCTGCAGCAGCTTGTCAGCCAACTCCACTGCCCGCTGGGCTGGCACAGAGATCTCCACACCATCTTCTCCTGTGTATCCACAGCGAGTCACTCTGCAGCCAGGGATGCCAAACACAGTTGTGTAAACACTGGTCATGAATGTTAGCTTGAAAAGATCATCAGTTAGTCCAGCCTGGAAAAATCCAGCAGAAAGGGGGACCTTGCACTGGCCAGAAGAACCAAATTAAATGTGTTCTAAAACCAACATCCACGTCCCACCCGCCTTTTAAACCCGTGCCATTTTTAATTCCACCAGTTTGGGGCC
Full Trace Sequence: CGGGAATCTGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTAGGGTATAATACTTTGCAGGCACAAATGGCATTTTGGTGGTAACACCATCTACAATCTTCTTCCTGACTTCAAAACGCACGGCTGTGCCAGCTTTTGCGTATTCTGGTTCCACATAGCCCATGGCCACATTAACTCGCAGACTGGGCGAAGGGCAACCGCTGGTCACTTCACCAATAACACGCCCCTCTAGGTTCAGGATAGGCGCATGCTGCCGGACTGGAGGTCCTGTTGAGGTCAGACCAACTCGCTTATGTTTCACTTTTCCTTTAATCTGAGGGACAATGACCGAGGCTCCTGGAAAATCCATTGCTGTTCTGCGTCGTTTTCCAAGAGTCCAAACCAAGCTGGCTTCCACTGGAGTGGTGGTCTCATCAATGTCATTGCCATACAGACATAACCCAGCCTCCAGGCGCAAACTGTCACGTGCTGCCAGACCTGCCAACTTCACATCACTGTTCTGCAGCAGCTTGTCAGCCAACTCCACTGCCCGCTGGGCTGGCACAGAGATCTCCACACCATCTTCTCCTGTGTATCCACAGCGAGTCACTCTGCAGCCAGGGATGCCAAACACAGTTGTGTAAACACTGGTCATGAATGTTAGCTTGAAAAGATCATCAGTTAGTCCAGCCTGGAAAAATCCAGCAGAAAGGGGGACCTTGCACTGGCCAGAAGAACCAAATTAAATGTGTTCTAAAACCAACATCCACGTCCCACCCGCCTTTTAAACCCGTGCCATTTTTAATTCCACCAGTTTGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTAGGGTATAATACTTTGCAGG