ORFeome > amy2b ORF1 – XORFeome v1.0

amy2b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: amy2b
Gene ID: 6488144
Gene Page ID: 5725536
ORF Xenbase ID: 17264043

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056841
Original XGC clone length: 1536

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ839407
dbEST ID: 79657109
Trimmed Sequence: ATGAAGCTCCTTCTACTCTTGGTGACTATTGGGCTCTGCTCAGCCCAGTACAATCCTAACACTCAATCCGGACGAACATCTATTGTGCACCTGTTTGAATGGAAATGGGTTGATATTGCTGCAGAATGTGAGCGCTATTTGGGACCTAATGGCTTTGGAGGTGTCCAGATTTCACCACCAAATGAAAACATTGTTGTGACAAACCCCTATAGACCCTGGTGGGAGAGGTACCAACCTATAAGTTATAAGCTCTGCACTCGTTCTGGGAATGAACAACAGTTTAGAGACATGGTGACAAGATGTAACAATGTTGGGGTATATATTTATGTGGATGCCATAATCAACCATATGTGTGGCTCAGGTGGCGGTGCCGGCACTCATTCAACTTGTGGAAGCTACTTCAATGCAGGATCCAGGGATTTCCCAGTCCCCTATTCCGGCTTGGATTTTAATGATGGAAAGTGCAGGACTGGCAGTGGTGAAATAGAAAATTATGGGGATGCTAACCAGGTCCGAAACTGTCGTCTTGTTGGTCTCTTGGATTTGGCAATGGAGAAAGACTATGTTCGTGGGAAGATTGCCGAATACATGAACAATCTAATTAACATTGGGGTTGCTGGATTCAGACTGGATGCTGCTAAACATATGTGGCCCTGGAGACCTAAAAGCTATTTTCCACAAACTCAATAATCTGAACACAAAATGGTTCCCCTGCCTGGAGCTCGACTTTTCATCTTTCCAAAAGGTAAATTAATCTTGGGGGGTTA
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGCTCCTTCTACTCTTGGTGACTATTGGGCTCTGCTCAGCCCAGTACAATCCTAACACTCAATCCGGACGAACATCTATTGTGCACCTGTTTGAATGGAAATGGGTTGATATTGCTGCAGAATGTGAGCGCTATTTGGGACCTAATGGCTTTGGAGGTGTCCAGATTTCACCACCAAATGAAAACATTGTTGTGACAAACCCCTATAGACCCTGGTGGGAGAGGTACCAACCTATAAGTTATAAGCTCTGCACTCGTTCTGGGAATGAACAACAGTTTAGAGACATGGTGACAAGATGTAACAATGTTGGGGTATATATTTATGTGGATGCCATAATCAACCATATGTGTGGCTCAGGTGGCGGTGCCGGCACTCATTCAACTTGTGGAAGCTACTTCAATGCAGGATCCAGGGATTTCCCAGTCCCCTATTCCGGCTTGGATTTTAATGATGGAAAGTGCAGGACTGGCAGTGGTGAAATAGAAAATTATGGGGATGCTAACCAGGTCCGAAACTGTCGTCTTGTTGGTCTCTTGGATTTGGCAATGGAGAAAGACTATGTTCGTGGGAAGATTGCCGAATACATGAACAATCTAATTAACATTGGGGTTGCTGGATTCAGACTGGATGCTGCTAAACATATGTGGCCCTGGAGACCTAAAAGCTATTTTCCACAAACTCAATAATCTGAACACAAAATGGTTCCCCTGCCTGGAGCTCGACTTTTCATCTTTCCAAAAGGTAAATTAATCTTGGGGGGTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGCTCCTTCTACTCTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839406
dbEST ID: 79657108
Trimmed Sequence: TAGTTTGGCATTCACATGGATAGCAGCAAATGGGTCTTCATCAGTGTTGCTTATCTGAAAACGAGCAAAGCCATTTCCATCCACATTGATCTGCCTGCCTGTGCAGCGAGATCCCTCCTTCTGTCCTGAGATCACATCACAGTAGGTTCCACTTGGAAGGCCAGTATTCAGAGTAGCATCCAAGTACCTGTCATCATTATTAAAGACTATGAATCCTTTATTGCCACGTCCGAATGCAACTTGATTGCTCCCATTATCCCACCAGTTTGAGAAGGGTTGACCATTTACCACATTACGGAAGATAACCATGTTCTTTATCTGGCGCCATCTATGCTCACAGACCCAGTTGTCACCACATGTTGCATCAGCGTTGATAGGAACTGATTTGATAGACCCATCAGAATTAGTAGGAGGGCCAATCCAGTCATTTTGGTCCTTTCCATTCGATATGTTCCTAGTCCATCTGTAGCTAGACATGACACGAGTGAAACCATAAGGATGCGCCAGCATGAAGCCAACTCCCATTTTGTACAGACGTGCATCCCAGAANGTGAGAATGGAAGCTCCTCCAGCACCGTGTCCTCTTTGATTATCATGATTATCAACAAACACCAAAGCTCTATCATTGGGCATAAATCCCCAGCCTTCTCCCCAGTTCCCTAGATAGGCCATCTTTTTCTTCATTCCATTTTGCGGAATGAATCCCCCCCAGCTTGGC
Full Trace Sequence: GGCGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGTTTGGCATTCACATGGATAGCAGCAAATGGGTCTTCATCAGTGTTGCTTATCTGAAAACGAGCAAAGCCATTTCCATCCACATTGATCTGCCTGCCTGTGCAGCGAGATCCCTCCTTCTGTCCTGAGATCACATCACAGTAGGTTCCACTTGGAAGGCCAGTATTCAGAGTAGCATCCAAGTACCTGTCATCATTATTAAAGACTATGAATCCTTTATTGCCACGTCCGAATGCAACTTGATTGCTCCCATTATCCCACCAGTTTGAGAAGGGTTGACCATTTACCACATTACGGAAGATAACCATGTTCTTTATCTGGCGCCATCTATGCTCACAGACCCAGTTGTCACCACATGTTGCATCAGCGTTGATAGGAACTGATTTGATAGACCCATCAGAATTAGTAGGAGGGCCAATCCAGTCATTTTGGTCCTTTCCATTCGATATGTTCCTAGTCCATCTGTAGCTAGACATGACACGAGTGAAACCATAAGGATGCGCCAGCATGAAGCCAACTCCCATTTTGTACAGACGTGCATCCCAGAANGTGAGAATGGAAGCTCCTCCAGCACCGTGTCCTCTTTGATTATCATGATTATCAACAAACACCAAAGCTCTATCATTGGGCATAAATCCCCAGCCTTCTCCCCAGTTCCCTAGATAGGCCATCTTTTTCTTCATTCCATTTTGCGGAATGAATCCCCCCCAGCTTGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTTTGGCATTCACATGGATAG