ORFeome > anapc5 ORF1 – XORFeome v1.0

anapc5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: anapc5
Gene ID: 978477
Gene Page ID: 978470
ORF Xenbase ID: 17264085

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123367
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID: 51433
Ensembl gene IDs: ENSG00000089053
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 154500,253300,253400,253550,600334,603689,604145,605280,608807,608808

Library Location

Plate ID: GDExl11084
Well Location: A06

Sequences - 5ʹ (forward) EST

Accession: JZ837493
dbEST ID: 79655195
Trimmed Sequence: ATGGCCAGCGTTCATGAAAGCCTGTATTTTAACCCCATGATGACCAACGGGGTAGTTCACGCCAATGTGTTCGGTATAAAGGACTGGGTGACGCCGTACAAGATCTCAGTGCTAGTGTTGCTGAGCGAGATGAGTAAGAATACGAAAATCAGCTTGGTGGAGAAGAGGCGCTTAAACAAGCAAATCCTTCCCCTCCTGCAGGGACCAGATATGACTCTTTCTAAACTAATTAAGATTGTTGAAGAGTGCTGTCCAAATGTCTCAAGCTCTGTCCATATCAGAATAAAGTTGATGGCTGAAGGAGAACTAAAGGACATGGAGCAATTCTTTGATGATCTTGCTGATTCCTTTACAGGAACTGAACCCGAAGTGCACAAAACAAGTGTTGTTGGACTTTTCCTTCGACACATGATCTTGGCATACAACAAACTTTCCTTCAGTCAAGTATACAAGCTGTACACTTCGTTGCAGCAATATTTTCAGAGTGAGAAAAGCAAGGCCACTTCAAAGACAGATAGTGATGAGGCAGATATGGATCTTACTAACAATGACGAGGAAGAAGGAAAACTGGAGAAAGAAGATCTGGATTTCCCTATTGGGGGAGGACGAACTTGGCTTGCAGTGGCCCATTATCCCAGAAACAAGCAGAATATTTCCTCTCTCAACAGGCCTCTTTAATGAAGAGTGATGAGAACAAAGCCCTGACCCCAGTCTTACTGCAAAAAGAACAAATAAATCTGGTGGAATTTCAACCCTTGATTTTCCCAGAAAGCTCCTTTACTTTAACCTTATTTAAAACAATTCGGC
Full Trace Sequence: GGGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAGCGTTCATGAAAGCCTGTATTTTAACCCCATGATGACCAACGGGGTAGTTCACGCCAATGTGTTCGGTATAAAGGACTGGGTGACGCCGTACAAGATCTCAGTGCTAGTGTTGCTGAGCGAGATGAGTAAGAATACGAAAATCAGCTTGGTGGAGAAGAGGCGCTTAAACAAGCAAATCCTTCCCCTCCTGCAGGGACCAGATATGACTCTTTCTAAACTAATTAAGATTGTTGAAGAGTGCTGTCCAAATGTCTCAAGCTCTGTCCATATCAGAATAAAGTTGATGGCTGAAGGAGAACTAAAGGACATGGAGCAATTCTTTGATGATCTTGCTGATTCCTTTACAGGAACTGAACCCGAAGTGCACAAAACAAGTGTTGTTGGACTTTTCCTTCGACACATGATCTTGGCATACAACAAACTTTCCTTCAGTCAAGTATACAAGCTGTACACTTCGTTGCAGCAATATTTTCAGAGTGAGAAAAGCAAGGCCACTTCAAAGACAGATAGTGATGAGGCAGATATGGATCTTACTAACAATGACGAGGAAGAAGGAAAACTGGAGAAAGAAGATCTGGATTTCCCTATTGGGGGAGGACGAACTTGGCTTGCAGTGGCCCATTATCCCAGAAACAAGCAGAATATTTCCTCTCTCAACAGGCCTCTTTAATGAAGAGTGATGAGAACAAAGCCCTGACCCCAGTCTTACTGCAAAAAGAACAAATAAATCTGGTGGAATTTCAACCCTTGATTTTCCCAGAAAGCTCCTTTACTTTAACCTTATTTAAAACAATTCGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAGCGTTCATGAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837492
dbEST ID: 79655194
Trimmed Sequence: GTGTCCAAAGCGGCAGTGCAGGGCAGCAAGATTCAATGCAGCATATCGCAAACTCCGCCCATATCCTTCATCTCCATTACTTTTACTCTCTGCACCAGTGAGAATCAAGCGGTCAAAGTAATGCAATAGGCTATGTGTTGAACTGAACACATCTTGAACACGCAGACTGTTTAAATAGCTTAAGTAATGAGCTTCTGCGAAATCAGGGTTGAACTTCAACAGATTATTTAGTTCCTTTTGCAGTAAGACTGGGGTCAGGGCCTTGTTCTCATCACTCTTCATTAAAGAGGCCTGTTGAGAGAGGAAATATTCTGCTTGTTTCTGGGATAATGGGCCACTGCAAGCCAAGTCGTCCTCCCCAATAGGGAAATCCAGATCTTCTTTCTCCAGTTTTCCTTCTTCCTCGTCATTGTTAGTAAGATCCATATCTGCCTCATCACTATCTGTCTTTGAAGTGGCCTTGCTTTTCTCACTCTGAAAATATTGCTGCAACGAANTGTACAGCTTGTATACTTGACTGAAGGAAAGTTTGTTGTATGCCAAAATCATGTGTCGAAGGAAAAGTCCACAACACTTGTTTTGTGCACTTCGGGTTCAATTCCTGTAAAGGATTAACAAAATCATCAAAAATTGGTCCCTGTCCTTTAATTCTCCCTCACCCACCACCTTTTTTCCTGATAGGGAACAAAACTTGGAAAAAATTGGGACAGCCACTCTTTCACAAATCCAAAATTAAATTAAAAAAAAAAAGTCAAAATTCTGGGGGC
Full Trace Sequence: CGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGTCCAAAGCGGCAGTGCAGGGCAGCAAGATTCAATGCAGCATATCGCAAACTCCGCCCATATCCTTCATCTCCATTACTTTTACTCTCTGCACCAGTGAGAATCAAGCGGTCAAAGTAATGCAATAGGCTATGTGTTGAACTGAACACATCTTGAACACGCAGACTGTTTAAATAGCTTAAGTAATGAGCTTCTGCGAAATCAGGGTTGAACTTCAACAGATTATTTAGTTCCTTTTGCAGTAAGACTGGGGTCAGGGCCTTGTTCTCATCACTCTTCATTAAAGAGGCCTGTTGAGAGAGGAAATATTCTGCTTGTTTCTGGGATAATGGGCCACTGCAAGCCAAGTCGTCCTCCCCAATAGGGAAATCCAGATCTTCTTTCTCCAGTTTTCCTTCTTCCTCGTCATTGTTAGTAAGATCCATATCTGCCTCATCACTATCTGTCTTTGAAGTGGCCTTGCTTTTCTCACTCTGAAAATATTGCTGCAACGAANTGTACAGCTTGTATACTTGACTGAAGGAAAGTTTGTTGTATGCCAAAATCATGTGTCGAAGGAAAAGTCCACAACACTTGTTTTGTGCACTTCGGGTTCAATTCCTGTAAAGGATTAACAAAATCATCAAAAATTGGTCCCTGTCCTTTAATTCTCCCTCACCCACCACCTTTTTTCCTGATAGGGAACAAAACTTGGAAAAAATTGGGACAGCCACTCTTTCACAAATCCAAAATTAAATTAAAAAAAAAAAGTCAAAATTCTGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTCCAAAGCGGCAGT