ORFeome > angptl2 ORF1 – XORFeome v1.0

angptl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: angptl2
Gene ID: 865770
Gene Page ID: 488163
ORF Xenbase ID: 17264103

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130068
Original XGC clone length: 1482

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ837604
dbEST ID: 79655306
Trimmed Sequence: ATGGTACCCCTAAGGATCTGTATTTTGCTCCTCTTCGTGGCATTAAGGGGCTCACATGGGGGCAACACCCAGGAATTCCAGAGCAGTGAAGGGTCGGAGCAGGAGTTTATTTACATGAACAGAGAGAGGCGAGCGGTGCCGGAGTCACATGACAAGTGCACCTACACGTTTATTGTGCCCCAGCAGAAGGTGACGGGGGCCATTTGTGTGAACTCCAAGGATCAGGAGCCGGGGTATGAAACGCGTCTGCACAAGCAGGAGATAGAGCTGCTGAATAGTGAGCTCCTCAAGCAGAAGCGGCAGATCGAGGCCCTGCAGCAGATGGTGGAGGTGGACGGCGGAATCGTCAACGAGGTGAAACTGCTGCGGAAGGAGAGTCGGAACATGAACTCGCGGGTGACCCAGTTGTACATGCAGCTGCTGCACGAGATCATCCGCAAGAGGGACAATGCCTTGGAACTGTCTCAGCTGGAGAACAAGGTCCTTAACCAGACGGCCGAGATGCTGCAACTCACCAACAAGTACAAAGACCTGGAGCACAAGTACCAGCACTTGGCCTCGCTCGCCAGCAACCAGTCCATCGTTATCTCCCAGCTGGAGGAACACTGCAGAAAGGTGCCCCCGACCCAAACTAAACCCCTCCCACAGCCCCCACAGCAGCCCAACAGGGTTTATAACCCCCCCCCACTCACAACCCCATCAACCACCAAAATTTCAACCAATTGAAAAATTCAGGGAAAATCAAAAAATTTAAAGGGTC
Full Trace Sequence: CCGAGGGCCCATATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTACCCCTAAGGATCTGTATTTTGCTCCTCTTCGTGGCATTAAGGGGCTCACATGGGGGCAACACCCAGGAATTCCAGAGCAGTGAAGGGTCGGAGCAGGAGTTTATTTACATGAACAGAGAGAGGCGAGCGGTGCCGGAGTCACATGACAAGTGCACCTACACGTTTATTGTGCCCCAGCAGAAGGTGACGGGGGCCATTTGTGTGAACTCCAAGGATCAGGAGCCGGGGTATGAAACGCGTCTGCACAAGCAGGAGATAGAGCTGCTGAATAGTGAGCTCCTCAAGCAGAAGCGGCAGATCGAGGCCCTGCAGCAGATGGTGGAGGTGGACGGCGGAATCGTCAACGAGGTGAAACTGCTGCGGAAGGAGAGTCGGAACATGAACTCGCGGGTGACCCAGTTGTACATGCAGCTGCTGCACGAGATCATCCGCAAGAGGGACAATGCCTTGGAACTGTCTCAGCTGGAGAACAAGGTCCTTAACCAGACGGCCGAGATGCTGCAACTCACCAACAAGTACAAAGACCTGGAGCACAAGTACCAGCACTTGGCCTCGCTCGCCAGCAACCAGTCCATCGTTATCTCCCAGCTGGAGGAACACTGCAGAAAGGTGCCCCCGACCCAAACTAAACCCCTCCCACAGCCCCCACAGCAGCCCAACAGGGTTTATAACCCCCCCCCACTCACAACCCCATCAACCACCAAAATTTCAACCAATTGAAAAATTCAGGGAAAATCAAAAAATTTAAAGGGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTACCCCTAAGGATCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837603
dbEST ID: 79655305
Trimmed Sequence: GTGGAAAGTGTTGGGGTTGGGCCTGATCATCATGACGACTTTCTTTAATGAGTACGACCCGCCTCTAAATTCGGCCCAGTAAACTCCATCTTGGTACCGGCTACGGTAGTGCCCTCCTCTGTACCAGACCCCGTTGAGGTTAGAGTGTGCACAAGCATTGTACCACCAGCCACCCTTCTGGTAGTGAGCACAGTTACCTGAATACACGTCGTGGTCCCTGTCCAGTGTAGTGAACTGTTTGCCATTGTGCCAGGTGAAAGAGTCCCCGGCATTGCCGTGGTAACGACCCAACCGAAGCTTGTAGTATTCGCTCTCCGGCTCCAGGCGGAAACTGGCATATTCAGCAAACATTTTGCGGCCTGACCAGTCCTCCATGGTGATCAGCAGTTTGTAGTTGTCTTGGTTCGTCAACCAGTAGATATTTTCAAGGCCCAGCCAATATTCGCCATCGATGTTGCCGAATCCAAGCTTGTAAGTCTCCCAGTTCCTGAAGAAGTTGACGGATCCATCCAAACGTCTCTGAATGACGGTCCAACCGCCAGGGTCATGCCGCTGGTCACACCACACCTGCATGAGTCTGTTGGTAATTTCAGGCTTCACTAAGTATATACTGCCTGGTGTCATGTCCATCTTTCATTGCCTTCCAAACCGCCTTCCCTTGGTCCAAAAGGGCCTTGTCCGTGGAAATTGGAATTTGCTTGGTGAAATAAAAGGCCATGGTGGGCCAAAAGGAGGGTGGCCAAAACCCTTTAAAATTCCTAATTCTCCCCTTGAAAT
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATANGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGAAAGTGTTGGGGTTGGGCCTGATCATCATGACGACTTTCTTTAATGAGTACGACCCGCCTCTAAATTCGGCCCAGTAAACTCCATCTTGGTACCGGCTACGGTAGTGCCCTCCTCTGTACCAGACCCCGTTGAGGTTAGAGTGTGCACAAGCATTGTACCACCAGCCACCCTTCTGGTAGTGAGCACAGTTACCTGAATACACGTCGTGGTCCCTGTCCAGTGTAGTGAACTGTTTGCCATTGTGCCAGGTGAAAGAGTCCCCGGCATTGCCGTGGTAACGACCCAACCGAAGCTTGTAGTATTCGCTCTCCGGCTCCAGGCGGAAACTGGCATATTCAGCAAACATTTTGCGGCCTGACCAGTCCTCCATGGTGATCAGCAGTTTGTAGTTGTCTTGGTTCGTCAACCAGTAGATATTTTCAAGGCCCAGCCAATATTCGCCATCGATGTTGCCGAATCCAAGCTTGTAAGTCTCCCAGTTCCTGAAGAAGTTGACGGATCCATCCAAACGTCTCTGAATGACGGTCCAACCGCCAGGGTCATGCCGCTGGTCACACCACACCTGCATGAGTCTGTTGGTAATTTCAGGCTTCACTAAGTATATACTGCCTGGTGTCATGTCCATCTTTCATTGCCTTCCAAACCGCCTTCCCTTGGTCCAAAAGGGCCTTGTCCGTGGAAATTGGAATTTGCTTGGTGAAATAAAAGGCCATGGTGGGCCAAAAGGAGGGTGGCCAAAACCCTTTAAAATTCCTAATTCTCCCCTTGAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGAAAGTGTTGGGGTTG