ORFeome > ank1 ORF1 – XORFeome v1.0

ank1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ank1
Gene ID: 6255864
Gene Page ID: 5838515
ORF Xenbase ID: 17264115

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129672
Original XGC clone length: 552

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ838643
dbEST ID: 79656345
Trimmed Sequence: ATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGGCAGAGGACGAAAATGACACTGTCAGATCAGAGGTCGCAGACGGGAGAAAGGGTGCACAGATTGTGAAACGAGCCGGCACCAAACGGGTGCAACAGTT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGGGGTTCCTGACAGAGCTGGGGGTGTGCATAGTGCTGATAGGATTCTTTGTGGTGAGCTGTCAGAATGTAGTGCACATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCATTCCGAGCTTGACAAAGAACTTGGTGAAGGAGGTGGAGAAGATGATGAAGAGACATTGACCACTAAAGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAATGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAATTCACAGATGAGCAGGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTAATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCATCGAGAGGCAGAGGACGAAAATGACACTGTCAGATCAGAGGTCGCAGACGGGAGAAAGGGTGCACAGATTGTGAAACGAGCCGGCACCAAACGGGTGCAACAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTTCAACGAACAGGTCACTATTAGTTCACATAAAATCATTTTTTTCCAATCACCTGATATCCCCAATAGTGAGTCCCTTTTAAAAAAAAAAAAAAAGAAATACTGAATTCTCAAGCCCCGGGTTTCAAATCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGGGGTTCCTGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838642
dbEST ID: 79656344
Trimmed Sequence: CTGTTGCACCCGTTTGGTGCCGGCTCGTTTCACAATCTGTGCACCCTTTCTCCCGTCTGCGACCTCTGATCTGACAGTGTCATTTTCGTCCTCTGCCTCTCGATGCAGTACAGCATACTTCAGGTAATTTGGGGTTTCACTTTCCAGGTCTTCTGGTTCCTGCAGTGTCCCCTCTATTAAAAGGTCCTCATTATCCCCTAAATCTGTGGTTCCTGGTGGACCCACTCTGCGTAGAACCTTCCGGACTATCTTCTTTGTCACAATGTTCCCCTGCTCATCTGTGAATTCTTCCTCTGTCACCTGTTCCCCAGGAATATCTGGGACTTCATTCCCCTTGACGATGACCCTCCTCCTCACAACTTTAGTGGTCAATGTCTCTTCATCATCTTCTCCACCTCCTTCACCAAGTTCTTTGTCAAGCTCGGAATGGAGTCGGCGAAGAACAAATTTACCAGCTCCCCGAACAATGTGCACTACATTCTGACAGCTCACCACAAACAATCCTATCAGCACTATGCACACCCCCACCTCTGTCAGGAACCCCCAAATGGTGCCAACTTCATTGTACAAAGTTGGGATTATAAAAAAGCAATGCTCAACAATTTTTTGCAACTAAAAAGGTCACTATCAGTACAAAAAAAAAACATTATATACAGTCCTAACTTAGGACTGGCCAATCTTTTACGACAAATATGCCACAGGGTCCGTGGAAACAAGGGGTCCTGGGTTAACCGTTTGTTTAAACGAAAAAACGCCCCAACCAAGAGAAACTACCCCCGGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGTTGCACCCGTTTGGTGCCGGCTCGTTTCACAATCTGTGCACCCTTTCTCCCGTCTGCGACCTCTGATCTGACAGTGTCATTTTCGTCCTCTGCCTCTCGATGCAGTACAGCATACTTCAGGTAATTTGGGGTTTCACTTTCCAGGTCTTCTGGTTCCTGCAGTGTCCCCTCTATTAAAAGGTCCTCATTATCCCCTAAATCTGTGGTTCCTGGTGGACCCACTCTGCGTAGAACCTTCCGGACTATCTTCTTTGTCACAATGTTCCCCTGCTCATCTGTGAATTCTTCCTCTGTCACCTGTTCCCCAGGAATATCTGGGACTTCATTCCCCTTGACGATGACCCTCCTCCTCACAACTTTAGTGGTCAATGTCTCTTCATCATCTTCTCCACCTCCTTCACCAAGTTCTTTGTCAAGCTCGGAATGGAGTCGGCGAAGAACAAATTTACCAGCTCCCCGAACAATGTGCACTACATTCTGACAGCTCACCACAAACAATCCTATCAGCACTATGCACACCCCCACCTCTGTCAGGAACCCCCAAATGGTGCCAACTTCATTGTACAAAGTTGGGATTATAAAAAAGCAATGCTCAACAATTTTTTGCAACTAAAAAGGTCACTATCAGTACAAAAAAAAAACATTATATACAGTCCTAACTTAGGACTGGCCAATCTTTTACGACAAATATGCCACAGGGTCCGTGGAAACAAGGGGTCCTGGGTTAACCGTTTGTTTAAACGAAAAAACGCCCCAACCAAGAGAAACTACCCCCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTTGCACCCGTTTGG