ORFeome > ankrd2 ORF1 – XORFeome v1.0

ankrd2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ankrd2
Gene ID: 6253914
Gene Page ID: 1016693
ORF Xenbase ID: 17264175

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044065
Original XGC clone length: 936

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ823612
dbEST ID: 79641314
Trimmed Sequence: ATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGGGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTAAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAACTGGAAGTAGTGAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGCACACCTCTCCATGTTGCTACACGCACTGGTCATGCTCATATTGTGGAGCACCTGATGGCTACT
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTGAAATGGGCGACCGATATTATTGATCAGAAGCTGGAACTGGAGGAACATGAGAAGGCAAAGCCACGTTTTCGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAAAAATACCAGCCGCCTGTGAATCGAAATCTTGCCAATTTAAAGGGTGATGACCGCGTGAGGAAGACTTCAGTTGACCTGAGAAAAGAAATTATTGATGTTGGTGGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGACAGTTGCTCTCGAACCACCTCCTGAGCCAGAGCTTACAGGACCTGTCACTGCTGAGGCATTCCTCAAGGCTGCTGCTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAGGAGAACAGCACTTCACAGGGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTAAGGGACAGGCTGGATTGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAACTGGAAGTAGTGAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAAGCTCCTTAGCACACCTCTCCATGTTGCTACACGCACTGGTCATGCTCATATTGTGGAGCACCTGATGGCTACT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTGAAATG

Sequences - 3ʹ (reverse) EST

Accession: JZ828911
dbEST ID: 79646613
Trimmed Sequence: CACTTGCTTCTCTGAAACAGTGTTTGACCTTTTCACCAACATCTCTTTGGTGTCTGCCTGCCACTGCTGCACAAGGTCTGTGGGAGTTTTGCCGTCTGCATTCTTTGCCATCATGTTGGAGCCGTATAAAATAAGCATTTTGATGATTTTGTACCGATTAAGTCTGACGGAATCATGAAGAGCAGTGTCACCTTCCCTGTCTCTGGCATTAATTTCCACACCAGTAGCAATCAGGTGCTCCACAATATGAGCATGACCAGTGCGTGTAGCAACATGGAGAGGTGTGCTAAGGAGCTTGTCTTTGACATTTATTTCTGCTCCACTATCCTGAAGAAGCTTCACTACTTCCAGTTTCCCTCCACGGCAGGCCCAGTGAATAGCAGTGCAATCCAGCCTGTCCCTTAAGTTGACCGATGATCCACTGTCTAAAAGTTTCTTGATGATTTCTATGTGACCCTCCAATGATGCCCTGTGAAGTGCTGTTCTCCTGAACTCATCACAAGTGTCTGGAGAGCCACCATCCTCCAAGAACTTCTCAATGATGTTCATCTTGCCGTCAGCAGCAGCCTTGAGGAATGCCTCAGCAGTGACAGGTCCTGTAAGCTCTGGCTCANGAGGTGGTTCGAGAGC
Full Trace Sequence: GCGGCCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAACAGTGTTTGACCTTTTCACCAACATCTCTTTGGTGTCTGCCTGCCACTGCTGCACAAGGTCTGTGGGAGTTTTGCCGTCTGCATTCTTTGCCATCATGTTGGAGCCGTATAAAATAAGCATTTTGATGATTTTGTACCGATTAAGTCTGACGGAATCATGAAGAGCAGTGTCACCTTCCCTGTCTCTGGCATTAATTTCCACACCAGTAGCAATCAGGTGCTCCACAATATGAGCATGACCAGTGCGTGTAGCAACATGGAGAGGTGTGCTAAGGAGCTTGTCTTTGACATTTATTTCTGCTCCACTATCCTGAAGAAGCTTCACTACTTCCAGTTTCCCTCCACGGCAGGCCCAGTGAATAGCAGTGCAATCCAGCCTGTCCCTTAAGTTGACCGATGATCCACTGTCTAAAAGTTTCTTGATGATTTCTATGTGACCCTCCAATGATGCCCTGTGAAGTGCTGTTCTCCTGAACTCATCACAAGTGTCTGGAGAGCCACCATCCTCCAAGAACTTCTCAATGATGTTCATCTTGCCGTCAGCAGCAGCCTTGAGGAATGCCTCAGCAGTGACAGGTCCTGTAAGCTCTGGCTCANGAGGTGGTTCGAGAGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAACAGT