ORFeome > ankrd2 ORF2 – XORFeome v1.0

ankrd2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ankrd2
Gene ID: 6254572
Gene Page ID: 1016693
ORF Xenbase ID: 17264181

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078087
Original XGC clone length: 936

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11043
Well Location: H07

Sequences - 5ʹ (forward) EST

Accession: JZ828199
dbEST ID: 79645901
Trimmed Sequence: ATGGAGGACGAAGTCAAATGGGCGACCGATATTATTGATCAGAAGCTGGAGCTGGAGGAACATGAGAAGGTAAAGCCTCGTTTTAGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAGAAATACCAGCCACCGGTGAATCGAAATCTCGCTAATTTAAAGGGTGATGACCGTGTGAGGAAGACTTCTGTTGACCTAAGAAAAGAAATTATCGATGTCGGTAGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGATAGTTGCTCCTGAACCACCTCCGGAGCCAGAGCTTACAGGACCTGTCACTGCCGAGGCATTCCTCAAGGCTGCTGTTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAAGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTAGTAAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAACCTACTAAGTACCCCTCTCCCTGTGGCCACACGCCCTGGTCCTGCTCATATTGTGGAACACCTGAT
Full Trace Sequence: GGGGGTCTAGCTGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTCAAATGGGCGACCGATATTATTGATCAGAAGCTGGAGCTGGAGGAACATGAGAAGGTAAAGCCTCGTTTTAGGAAGATAGGTGTTGTTGACATTGATTCCAGTGATTTAAATGATGAGAAATACCAGCCACCGGTGAATCGAAATCTCGCTAATTTAAAGGGTGATGACCGTGTGAGGAAGACTTCTGTTGACCTAAGAAAAGAAATTATCGATGTCGGTAGCATCCAAAATCTAATTGAAATACGAAAAAAGAGACAGGAGAGAAAAAAGAAGAAGTCATTGATAGTTGCTCCTGAACCACCTCCGGAGCCAGAGCTTACAGGACCTGTCACTGCCGAGGCATTCCTCAAGGCTGCTGTTGACGGCAAGATGAACATCATTGAGAAGTTCTTGGAGGATGGTGGCTCTCCAGACACTTGTGATGAGTTCAAGAGAACAGCACTTCACAGAGCATCATTGGAGGGTCACATAGAAATCATCAAGAAACTTTTAGACAGTGGATCATCGGTCAACTTCAGGGATAGGCTGGATAGCACTGCTATTCACTGGGCCTGCCGTGGAGGGAAGCTGGATGTAGTAAAGCTTCTTCAGGATAGTGGAGCAGAAATAAATGTCAAAGACAACCTACTAAGTACCCCTCTCCCTGTGGCCACACGCCCTGGTCCTGCTCATATTGTGGAACACCTGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGACGAAGTCAAATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ828198
dbEST ID: 79645900
Trimmed Sequence: CACTTGCTTCTCTGAAACGGTGTTTGACTTTTTCACCAACATCTCTTTGGTGTCTGCCTGCCATTGCTGCACAAGGTCTGTGGGAGTTTTGCCGTCTGCATTCTTTGCCATCATATTGGCTCCGTATAAAATAAGCATTTTGATGATCTTGTAGCGATTAAGTCTGACAGAATCATGAAGAGCAGTGTCACCTTCCCTATCCCTGCCATTGATTTCTACACCAGTAGCAATCAGGTGCTCCACAATATGAGCATGACCAGTGCGTGTGGCCACATGGAGAGGTGTACTTAGTAGCTTGTCTTTGACATTTATTTCTGCTCCACTATCCTGAAGAAGCTTTACTACATCCAGCTTCCCTCCACGGCAGGCCCAGTGAATAGCAGTGCTATCCAGCCTATCCCTGAAGTTGACCGATGATCCACTGTCTAAAAGTTTCTTGATGATTTCTATGTGACCCTCCAATGATGCTCTGTGAAGTGCTGTTCTCTTGAACTCATCACAAATGTCTGGAGAGCCACCATCCTCCAAGAACTTCTCAATGATGTTCATCTTGCCGTCAAAAACAGCCTTGAAGAATGCCTCGGCAGTGACAGGTCCTGTAAACTCCTGGCTCCGGAGGTGGTTCAGGAGCAACTAAAAATTAACTTCCTCTTTTTTCTTC
Full Trace Sequence: GGGCCGCGGAGAGGCTATGACCATGTAATACGACTCACTATAGAGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAACGGTGTTTGACTTTTTCACCAACATCTCTTTGGTGTCTGCCTGCCATTGCTGCACAAGGTCTGTGGGAGTTTTGCCGTCTGCATTCTTTGCCATCATATTGGCTCCGTATAAAATAAGCATTTTGATGATCTTGTAGCGATTAAGTCTGACAGAATCATGAAGAGCAGTGTCACCTTCCCTATCCCTGCCATTGATTTCTACACCAGTAGCAATCAGGTGCTCCACAATATGAGCATGACCAGTGCGTGTGGCCACATGGAGAGGTGTACTTAGTAGCTTGTCTTTGACATTTATTTCTGCTCCACTATCCTGAAGAAGCTTTACTACATCCAGCTTCCCTCCACGGCAGGCCCAGTGAATAGCAGTGCTATCCAGCCTATCCCTGAAGTTGACCGATGATCCACTGTCTAAAAGTTTCTTGATGATTTCTATGTGACCCTCCAATGATGCTCTGTGAAGTGCTGTTCTCTTGAACTCATCACAAATGTCTGGAGAGCCACCATCCTCCAAGAACTTCTCAATGATGTTCATCTTGCCGTCAAAAACAGCCTTGAAGAATGCCTCGGCAGTGACAGGTCCTGTAAACTCCTGGCTCCGGAGGTGGTTCAGGAGCAACTAAAAATTAACTTCCTCTTTTTTCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGCTTCTCTGAAACGG