ORFeome > ankrd37 ORF1 – XORFeome v1.0

ankrd37 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ankrd37
Gene ID: 984894
Gene Page ID: 984888
ORF Xenbase ID: 17264193

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141750
Original XGC clone length: 492

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ838874
dbEST ID: 79656576
Trimmed Sequence: ATGCAGCCGCTGTGTGACTCTGACTGTGATGGCCTAAGTGCACTGATGGAATGTGGAGGTGCCGTGAACTCCCCCGGAGACACAATGGGACAGTCCCCTGCACATCTAGCAGCATGTGGGGGACAGGCTTTTTTCCTGCTTTGGCAGCTGCACACTGGAGTGGATGTAAATCAGCAGGACTGCTTTGGAGAAGCTCCTATTCATAAAGCTGCTCGCTCAGGAAGCATGGAGTGTCTGAGCCTGCTGGTCGCTAGTGATGCCAGAATAGATATGTGTAACAGAGATGGGCACACGGCAGAAGAAGTGGCTTTGTCCTGTGGGTTTATAGACTGTGCGAGGTATCTCGCTACAGTGAAGCTCACGCAAGACACATTTTCCCGAGCGCAGTCGTCCATGCATGATCTGAAGGAGACAGCCGCCCAATTAAAACGAGGGAAATGTTGTCAGTCAGTTTCGCATGACAAGAGGCGGCGCTCTGATGGTTTTGTCTT
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGCCGCTGTGTGACTCTGACTGTGATGGCCTAAGTGCACTGATGGAATGTGGAGGTGCCGTGAACTCCCCCGGAGACACAATGGGACAGTCCCCTGCACATCTAGCAGCATGTGGGGGACAGGCTTTTTTCCTGCTTTGGCAGCTGCACACTGGAGTGGATGTAAATCAGCAGGACTGCTTTGGAGAAGCTCCTATTCATAAAGCTGCTCGCTCAGGAAGCATGGAGTGTCTGAGCCTGCTGGTCGCTAGTGATGCCAGAATAGATATGTGTAACAGAGATGGGCACACGGCAGAAGAAGTGGCTTTGTCCTGTGGGTTTATAGACTGTGCGAGGTATCTCGCTACAGTGAAGCTCACGCAAGACACATTTTCCCGAGCGCAGTCGTCCATGCATGATCTGAAGGAGACAGCCGCCCAATTAAAACGAGGGAAATGTTGTCAGTCAGTTTCGCATGACAAGAGGCGGCGCTCTGATGGTTTTGTCTTGCCAACTTTCTTGTACAGAGTTGGCATTATAAAAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATTAAATCATTATTTTCCATCCCGCCTGATATACCCCAGGGGGGAGTCCTATTACATTGTTAGAAAAAATAATCAAAAACAAAATTACAAATGGGTCCCTCTCGCCTCCCGAAAAAAAAGCTCGACTTCTCTTCCTCCCTCGGCTGCTTGTTGGTGGTTCTGTGGGAGAGAGATATAAGGGAAAAACCCAAGTACAACAGAGAGGTTGGTTGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGCCGCTGTGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838873
dbEST ID: 79656575
Trimmed Sequence: GACAAAACCATCAGAGCGCCGCCTCTTGCCATGCGAAACTGACTGACAACATTTCCCTCGTTTTAATTGGGCGGCTGTCTCCTTCAGATCATGCATGGACGACTGCGCTCGGGAAAATGTGTCTTGCGTGAGCTTCACTGTAGCGAGATACCTCGCACAGTCTATAAACCCACAGGACAAAGCCACTTCTTCTGCCGTGTGCCCATCTCTGTTACACATATCTATTCTGGCATCACTAGCGACCAGCAGGCTCAGACACTCCATGCTTCCTGAGCGAGCAGCTTTATGAATAGGAGCTTCTCCAAAGCAGTCCTGCTGATTTACATCCACTCCAGTGTGCAGCTGCCAAAGCAGGAAAAAAGCCTGTCCCCCACATGCTGCTAGATGTGCAGGGGACTGTCCCATTGTGTCTCCGGGGGAGTTCACGGCACCTCCACATTCCATCAGTGCACTTAGGCCATCACAGTCAGAGTCACACAGCGGCTGCATGG
Full Trace Sequence: AACGAGTGGTAATNACGACTCACTATNAGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACAAAACCATCAGAGCGCCGCCTCTTGCCATGCGAAACTGACTGACAACATTTCCCTCGTTTTAATTGGGCGGCTGTCTCCTTCAGATCATGCATGGACGACTGCGCTCGGGAAAATGTGTCTTGCGTGAGCTTCACTGTAGCGAGATACCTCGCACAGTCTATAAACCCACAGGACAAAGCCACTTCTTCTGCCGTGTGCCCATCTCTGTTACACATATCTATTCTGGCATCACTAGCGACCAGCAGGCTCAGACACTCCATGCTTCCTGAGCGAGCAGCTTTATGAATAGGAGCTTCTCCAAAGCAGTCCTGCTGATTTACATCCACTCCAGTGTGCAGCTGCCAAAGCAGGAAAAAAGCCTGTCCCCCACATGCTGCTAGATGTGCAGGGGACTGTCCCATTGTGTCTCCGGGGGAGTTCACGGCACCTCCACATTCCATCAGTGCACTTAGGCCATCACAGTCAGAGTCACACAGCGGCTGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCCATTAAATAAAAACCAAACAAAAGACTAGATCATCGAATTACACCTCTAAGGCATCGGGGAAAAATGGGTCCACCTCGCAGCCTGCCAGGGTTGTTGGGCGGTCGTTCCTGGGAAAAGGACGAAGGGAAAAAACAAATGGCAAAAGACCGGTTTGGGTTCGTAAGTGAAAGGACAAATAAAAAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACAAAACCATCAGAGCG