ORFeome > ankrd39 ORF1 – XORFeome v1.0

ankrd39 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ankrd39
Gene ID: 940553
Gene Page ID: 940550
ORF Xenbase ID: 17264199

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123179
Original XGC clone length: 549

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ838065
dbEST ID: 79655767
Trimmed Sequence: ATGGAGGGGCGAAAAGCGCACCCGGCCGGCGGCTCGTGCTCCTGCTGTACCGGGGCAGCCGCCAGTTTGCGAGAGACAGTGGAGGAGATGGACTTCCAGAGAGGTATCTGGTCGGCGGCTCTTGATGGAGACCTCAACAGAGTTAGACAGTTCATAAAGAAAGGAACAGACCCCAGCCTGCCTGACAACTTCGGCTACACAGCGCTGCATTACAGCAGTAGACAAGGATGTGTGCCAGTGTGCAGCTTTCTCTTGGATGTTGGTGCTGACTGCAATGCCCAGACACATGGGGGCGCCACATCTCTTCACAGAGCAGCGTATTGTGGACACCTGGAGGTGGTGCAGCTACTCCTAGAGCGAGGAGCTGACCCAGTAAAGACCGACTCCGACGGGAGAACAGCTCTTCACAAGGCAGCAGAAGGTGGCCACCGGAACATATGTCACCTGCTTCTAAATCACAGTAGCAAACTCTTGGAACTGCAGGACTGTAGGGGCCAGACTGCTGCGGACCTGACTCCTGCTGGTGTGAATCAGCTTTTACCCCCGTT
Full Trace Sequence: CTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGGCGAAAAGCGCACCCGGCCGGCGGCTCGTGCTCCTGCTGTACCGGGGCAGCCGCCAGTTTGCGAGAGACAGTGGAGGAGATGGACTTCCAGAGAGGTATCTGGTCGGCGGCTCTTGATGGAGACCTCAACAGAGTTAGACAGTTCATAAAGAAAGGAACAGACCCCAGCCTGCCTGACAACTTCGGCTACACAGCGCTGCATTACAGCAGTAGACAAGGATGTGTGCCAGTGTGCAGCTTTCTCTTGGATGTTGGTGCTGACTGCAATGCCCAGACACATGGGGGCGCCACATCTCTTCACAGAGCAGCGTATTGTGGACACCTGGAGGTGGTGCAGCTACTCCTAGAGCGAGGAGCTGACCCAGTAAAGACCGACTCCGACGGGAGAACAGCTCTTCACAAGGCAGCAGAAGGTGGCCACCGGAACATATGTCACCTGCTTCTAAATCACAGTAGCAAACTCTTGGAACTGCAGGACTGTAGGGGCCAGACTGCTGCGGACCTGACTCCTGCTGGTGTGAATCAGCTTTTACCCCCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAATCGTAATACGTGGTCCTAACCTTTATAAAAAAAAAAACATAAAAAATTTATAATATATCTTTTTAATTTTAAAAAGGGAGGAGAAAAAAAAAAAATTTCCCGCTCCTTGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGGCGAAAAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838064
dbEST ID: 79655766
Trimmed Sequence: CGGGGGTAAAAGCTGATTCACACCAGCAGGAGTCAGGTCCGCAGCAGTCTGGCCCCTACAGTCCTGCAGTTCCAAGAGTTTGCTACTGTGATTTAGAAGCAGGTGACATATGTTCCGGTGGCCACCTTCTGCTGCCTTGTGAAGAGCTGTTCTCCCGTCGGAGTCGGTCTTTACTGGGTCAGCTCCTCGCTCTAGGAGTAGCTGCACCACCTCCAGGTGTCCACAATACGCTGCTCTGTGAAGAGATGTGGCGCCCCCATGTGTCTGGGCATTGCAGTCAGCACCAACATCCAAGAGAAAGCTGCACACTGGCACACATCCTTGTCTACTGCTGTAATGCAGCGCTGTGTAGCCGAAGTTGTCAGGCAGGCTGGGGTCTGTTCCTTTCTTTATGAACTGTCTAACTCTGTTGAGGTCTCCATCAAGAGCCGCCGACCAGATACCTCTCTGGAAATCCATCTCCTCCACTGTCTCTCGCAAACTGGCGGCTGCCCCGGTACAGCAGGAGCACGAGCCGCCCGGCGGGGTGCGCTTTTCCCCCCCTCCTGG
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGGGGGTAAAAGCTGATTCACACCAGCAGGAGTCAGGTCCGCAGCAGTCTGGCCCCTACAGTCCTGCAGTTCCAAGAGTTTGCTACTGTGATTTAGAAGCAGGTGACATATGTTCCGGTGGCCACCTTCTGCTGCCTTGTGAAGAGCTGTTCTCCCGTCGGAGTCGGTCTTTACTGGGTCAGCTCCTCGCTCTAGGAGTAGCTGCACCACCTCCAGGTGTCCACAATACGCTGCTCTGTGAAGAGATGTGGCGCCCCCATGTGTCTGGGCATTGCAGTCAGCACCAACATCCAAGAGAAAGCTGCACACTGGCACACATCCTTGTCTACTGCTGTAATGCAGCGCTGTGTAGCCGAAGTTGTCAGGCAGGCTGGGGTCTGTTCCTTTCTTTATGAACTGTCTAACTCTGTTGAGGTCTCCATCAAGAGCCGCCGACCAGATACCTCTCTGGAAATCCATCTCCTCCACTGTCTCTCGCAAACTGGCGGCTGCCCCGGTACAGCAGGAGCACGAGCCGCCCGGCGGGGTGCGCTTTTCCCCCCCTCCTGGTGCCAACTTTTATTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCCTCAGTTTGTTGCCACGAACAGGTCCACATCAGTCAAAATTAAATCCTTAATTGGGGGCCCAAGAAAAGAAAAAGAAATATCATTAAAAGATTTTGTTAACGTGGGGGGGGGGGGGGGGGGAGAAACGCAACCCCCTCTCTCGCGCCGGGGCGGGGGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGGGGGTAAAAGCTGATT