ORFeome > anp32e ORF1 – XORFeome v1.0

anp32e ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: anp32e
Gene ID: 991621
Gene Page ID: 991615
ORF Xenbase ID: 17264247

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043985
Original XGC clone length: 792

Human orthology & disease relationships

NCBI Entrez ID: 81611
Ensembl gene IDs: ENSG00000143401
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 603776

Library Location

Plate ID: GDExl11015
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ824243
dbEST ID: 79641945
Trimmed Sequence: ATGGAGATGAAGAAGCGCATCAGCTTGGAGTTGAGGAACAGGAGCCCGGCTGAGGTGGCCGAATTGGTTTTAGACAATTGTCGGTCTGTCGATGGAGAAATTGAAGGTTTGAATGACAGCTACAAAGAGCTGGAGTTCCTCAGCATGGCCAACGTAGAGTTGAAATCCTTGTCAAAGCTTCCAAAGTTACCTAAACTCCGAAAACTGGAGCTTAGTGACAACAGTATCTCAGGAGGGCTGGATGTGTTGACCGAGAGGTGTCCAAACATAACTTACCTCAACCTGAGTGGTAACAAGATTAAAGACCTGAGCACAGTGGAGGCACTTGCCAGCTTAAAAAATCTAAAGAGCTTGGACCTGTTTAACTGTGAGATTACAAACCTAGAAGATTACAGAGAAAACATCTTTCAGCGACTTTCCCAAATTACATACCTGGATGGGTTTGACCAGGAGGATAACGAAGCTCCAGACTCCGAAGAAGATGATGATGATGATGATTACGATGATGATGAAGAGCCAGGACCTCGGCGTTATGAGGCAGAGGAAGATGAGGAAGACGAAGAAAGTGCCTCAGATTTAGGAGAGGAAGAAGAGGAGGAAGAAGAAGTTGGGCTGTCTTATTTGATGAAAGAGGAGATTCGTGATGAGGAGGATGATGATGACTATGTTGAAGATGGTGCAGAAAGAGAGGAAGAGGAGGAGGAAGATGAAAAAGATGAAGCAGCAGCAGCTGATCAGGNAGAGAAAAGGGAACGGGNACCCCGAGGAGAGGGAAGAAAGAGGGATGAGGGATTTTGCCAACTTTTTCTCTGGGACCAA
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGATGAAGAAGCGCATCAGCTTGGAGTTGAGGAACAGGAGCCCGGCTGAGGTGGCCGAATTGGTTTTAGACAATTGTCGGTCTGTCGATGGAGAAATTGAAGGTTTGAATGACAGCTACAAAGAGCTGGAGTTCCTCAGCATGGCCAACGTAGAGTTGAAATCCTTGTCAAAGCTTCCAAAGTTACCTAAACTCCGAAAACTGGAGCTTAGTGACAACAGTATCTCAGGAGGGCTGGATGTGTTGACCGAGAGGTGTCCAAACATAACTTACCTCAACCTGAGTGGTAACAAGATTAAAGACCTGAGCACAGTGGAGGCACTTGCCAGCTTAAAAAATCTAAAGAGCTTGGACCTGTTTAACTGTGAGATTACAAACCTAGAAGATTACAGAGAAAACATCTTTCAGCGACTTTCCCAAATTACATACCTGGATGGGTTTGACCAGGAGGATAACGAAGCTCCAGACTCCGAAGAAGATGATGATGATGATGATTACGATGATGATGAAGAGCCAGGACCTCGGCGTTATGAGGCAGAGGAAGATGAGGAAGACGAAGAAAGTGCCTCAGATTTAGGAGAGGAAGAAGAGGAGGAAGAAGAAGTTGGGCTGTCTTATTTGATGAAAGAGGAGATTCGTGATGAGGAGGATGATGATGACTATGTTGAAGATGGTGCAGAAAGAGAGGAAGAGGAGGAGGAAGATGAAAAAGATGAAGCAGCAGCAGCTGATCAGGNAGAGAAAAGGGAACGGGNACCCCGAGGAGAGGGAAGAAAGAGGGATGAGGGATTTTGCCAACTTTTTCTCTGGGACCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGATGAAGAAGCGCATCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829567
dbEST ID: 79647269
Trimmed Sequence: ATCCTCATCCTCATCTCCTTCATCCTCGGGGTCCCGTTTCCTTTTCTCTCCCTGATCAGCTGCTGCTGCTTCATCTTCTTCATCTTCCTCCTCCTCTTCCTCTCCTTCTGCACCATCTTCAACATAGTCATCATCATCCTCCTCATCACGAATCTCCTCTTTCATCAAATAAGACAGCCCAACTTCTTCTTCCTCCTCTTCTTCCTCTCCTAAATCTGAGGCACTTTCTTCGTCTTCCTCATCTTCCTCTGCCTCATAACGCCGAGGTCCTGGCTCTTCATCATCATCGTAATCATCATCATCATCATCTTCTTCGGAGTCTGGAGCTTCGTTATCCTCCTGGTCAAACCCATCCAGGTATGTAATTTGGGAAAGTCGCTGAAAGATGTTTTCTCTGTAATCTTCTAGGTTTGTAATCTCACAGTTAAACAGGTCCAAGCTCTTTAGATTTTTTAAGCTGGCAAGTGCCTCCACTGTGCTCAGGTCTTTAATCTTGTTACCACTCANGTTGAGGTAAGTTATGTTTGGACACCTCTCGGTCAACACATCCCGCCCTCCTGAAATACTGTTGTCACTAAGCTCCAGTTTTCCGAGTTTAGGTAACTTTGGAAGCTTTTACCAAGATTTCCACTCTACGTTGGGCCATGCTGAGGAACTCCAGCTCCTTTGTAGCTGTCATTTCAAACCTTTCAATTTTCCCCATCCAACAGAACCCAACAATTTGGTTTTAAAAACCAAATTTCGGGCC
Full Trace Sequence: GGCACGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCCTCATCCTCATCTCCTTCATCCTCGGGGTCCCGTTTCCTTTTCTCTCCCTGATCAGCTGCTGCTGCTTCATCTTCTTCATCTTCCTCCTCCTCTTCCTCTCCTTCTGCACCATCTTCAACATAGTCATCATCATCCTCCTCATCACGAATCTCCTCTTTCATCAAATAAGACAGCCCAACTTCTTCTTCCTCCTCTTCTTCCTCTCCTAAATCTGAGGCACTTTCTTCGTCTTCCTCATCTTCCTCTGCCTCATAACGCCGAGGTCCTGGCTCTTCATCATCATCGTAATCATCATCATCATCATCTTCTTCGGAGTCTGGAGCTTCGTTATCCTCCTGGTCAAACCCATCCAGGTATGTAATTTGGGAAAGTCGCTGAAAGATGTTTTCTCTGTAATCTTCTAGGTTTGTAATCTCACAGTTAAACAGGTCCAAGCTCTTTAGATTTTTTAAGCTGGCAAGTGCCTCCACTGTGCTCAGGTCTTTAATCTTGTTACCACTCANGTTGAGGTAAGTTATGTTTGGACACCTCTCGGTCAACACATCCCGCCCTCCTGAAATACTGTTGTCACTAAGCTCCAGTTTTCCGAGTTTAGGTAACTTTGGAAGCTTTTACCAAGATTTCCACTCTACGTTGGGCCATGCTGAGGAACTCCAGCTCCTTTGTAGCTGTCATTTCAAACCTTTCAATTTTCCCCATCCAACAGAACCCAACAATTTGGTTTTAAAAACCAAATTTCGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCTCATCCTCATCTCC