ORFeome > ap1ar ORF1 – XORFeome v1.0

ap1ar ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ap1ar
Gene ID: 5953419
Gene Page ID: 5953378
ORF Xenbase ID: 17264337

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129651
Original XGC clone length: 873

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G02

Sequences - 5ʹ (forward) EST

Accession: JZ837810
dbEST ID: 79655512
Trimmed Sequence: ATGGGGATCTGCTGGACTCGGTGCTGCAGCATCTTCAGAAGAGAGAGTAGCCGGATACAGAGAGCTGGCGGCGGATCAAAGTATTTTAAAACTACAACCAGAGGAGAGCATTTTACAATTGAGTTTGAAAACCTTGTTGAAAGTGATGAGGGAGAAAGTCCTGGCAGTAGTATAAGACCCTTGAGTGAGGAAGAATTGTGTGATCTAAAAGAAAAACAGTATGATTCTATTACGGAACGCCAGAGGGCTGATGATATCAAAATACAAAATGAGTTAGCCTTACAAGAGAAGAAGTTAAAACTAGAAGAGGAGTCTTTATATGCTGCACAACGGGAAGCAGCGAGGGCAGCCAAGCAAAGAAAGATTTTGGAGCAACACCGGTTGCAGTGGATAAAGCAAAGAGCACTAGCAGCTAAGAATGGAGAAGATCCAAGCTCTGTACCAGAAGATTTTGAAACCTACTTGCAGAATTTGAAGTTACAATATGGAGCTGTTAGGAACAGCAGATTGTCTTCTGAAGCAAACGTATTGACACCCAACACCGAAAGTAACTGTGAATTAACTACAAAAACAAAGTCAACCAGTGGGAATGATAACACATCCTCTGGACCTTGAGTGGGAGGGATGAAAAGGAAAGAACAGGATGAATTCCATGAACGAGCCGCTCAAAGAACAAAAAAGGACATACTAACCAACCAGCCTAAAAAAAAAATGGCAAAAAGGCCGTGGAAGCCTGGGAAGCCTCTGGCTTCCGTGAAGGAACCAACCTGGGGGTATAAAGTTGGAAAAAAAAAAATTTGGTGGGAAATTGGCCCAAAAA
Full Trace Sequence: CGGGGGCCAGATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGATCTGCTGGACTCGGTGCTGCAGCATCTTCAGAAGAGAGAGTAGCCGGATACAGAGAGCTGGCGGCGGATCAAAGTATTTTAAAACTACAACCAGAGGAGAGCATTTTACAATTGAGTTTGAAAACCTTGTTGAAAGTGATGAGGGAGAAAGTCCTGGCAGTAGTATAAGACCCTTGAGTGAGGAAGAATTGTGTGATCTAAAAGAAAAACAGTATGATTCTATTACGGAACGCCAGAGGGCTGATGATATCAAAATACAAAATGAGTTAGCCTTACAAGAGAAGAAGTTAAAACTAGAAGAGGAGTCTTTATATGCTGCACAACGGGAAGCAGCGAGGGCAGCCAAGCAAAGAAAGATTTTGGAGCAACACCGGTTGCAGTGGATAAAGCAAAGAGCACTAGCAGCTAAGAATGGAGAAGATCCAAGCTCTGTACCAGAAGATTTTGAAACCTACTTGCAGAATTTGAAGTTACAATATGGAGCTGTTAGGAACAGCAGATTGTCTTCTGAAGCAAACGTATTGACACCCAACACCGAAAGTAACTGTGAATTAACTACAAAAACAAAGTCAACCAGTGGGAATGATAACACATCCTCTGGACCTTGAGTGGGAGGGATGAAAAGGAAAGAACAGGATGAATTCCATGAACGAGCCGCTCAAAGAACAAAAAAGGACATACTAACCAACCAGCCTAAAAAAAAAATGGCAAAAAGGCCGTGGAAGCCTGGGAAGCCTCTGGCTTCCGTGAAGGAACCAACCTGGGGGTATAAAGTTGGAAAAAAAAAAATTTGGTGGGAAATTGGCCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGATCTGCTGGACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837809
dbEST ID: 79655511
Trimmed Sequence: CTTATTCTGATGCTGAGCAGACAGTTCTGTGACTGGATTTACAAACCCTGCATACTCAGAGTTCCCATTATCATCCATTTCGGCACTCACAAAGTCATTTTCCCACTCTAGCCCAGTTGAGTCATCAGAAGCAGAGGCTCCATGACTTCCAGGCTTTTTGCCACTATATTTTAAGGCTGCTTGTAAGATGTCCTCTTCTGTCTTTGAGCGCTCGTTCATAGGAATCATCCTGTTCATTCCTTCTTCATCCTCCCACTCAAGGTCAAGAGATGTGTTATCATTCCCACTTGTTGACTTTGTTTTTGTAGTTAAATCACAGCTACTTTCTGTGTTGGGTGTCAATACGTTTGCTTCAGAAGACAATCTGCTGCTCCTAACAGCTCCATATTGTAACTTCAAATTCTGCAAGTAGGTTTCAAAATCTTCTGGTACAGAGCTTGGATCTTCTCCATTCTTAGCTGCTAGTGCTCTTTGCTTTATCCACTGCAACCGGTGTTGCTCCAAAATCTTTCTTTGCTTGGCTGCCCTCGCTGCTTCCCGTTGTGCAGCATATAAAGACTCCTCTTCTAGTTTTAACTTCTTCTCTTGTAAGGCTAACTCATTTTGTATTTTGATATCATCAGCCCTCTGGCGTTCCGTAATAGAATCATACTGTTTTTCTTTTAGATCACACAATTCTTCCTCACTCAAGGGTCTTATACTACTGCCAGGACTGTCTCCCTCATCACTTTTCAACAAGTTTTCAAACTCAATTGAAAAATGCTCTCCTCTGGTTGGAGTTTTAAATACTTTGAATCCGCCCCCGGCTCTCTTTAACCGGCTACTCCTCTTTCCTGAAAAGCCTGCAACACCAGTCCCACAAAAACCCCTGGGGGCAAACTTTTTTGTAAAAGTTGGCCTTAATAAAAAACATTGGCTAACAAATTGTTGAAACAAAAAAGTCGTATCAGTCAAAATAAAATCATTAATTTGGAGACCAAAAAAAAAAAAGGACGAGAACTTAAAAAAGCCTTTTGCCCGGGGAGAAGACTGGGAGGGGANAAATAAGGAGGGAGGCAGGGGAGAGGAGAAAGAGGAAGAGGAAAGAGAAAGGNAGAGGGAAGGAGGAAGGGGAAGAAGAAAAGAGGATGAGGGAGAAGGGAGAGGAGGGAGANGAGGGCAGGACAGGGNGAAGAGGAGGGGNNCACCGAACTGAAGGAGAAGANGAGAAANGAAAGGC
Full Trace Sequence: GGGGCAAACAGGCTATTGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTATTCTGATGCTGAGCAGACAGTTCTGTGACTGGATTTACAAACCCTGCATACTCAGAGTTCCCATTATCATCCATTTCGGCACTCACAAAGTCATTTTCCCACTCTAGCCCAGTTGAGTCATCAGAAGCAGAGGCTCCATGACTTCCAGGCTTTTTGCCACTATATTTTAAGGCTGCTTGTAAGATGTCCTCTTCTGTCTTTGAGCGCTCGTTCATAGGAATCATCCTGTTCATTCCTTCTTCATCCTCCCACTCAAGGTCAAGAGATGTGTTATCATTCCCACTTGTTGACTTTGTTTTTGTAGTTAAATCACAGCTACTTTCTGTGTTGGGTGTCAATACGTTTGCTTCAGAAGACAATCTGCTGCTCCTAACAGCTCCATATTGTAACTTCAAATTCTGCAAGTAGGTTTCAAAATCTTCTGGTACAGAGCTTGGATCTTCTCCATTCTTAGCTGCTAGTGCTCTTTGCTTTATCCACTGCAACCGGTGTTGCTCCAAAATCTTTCTTTGCTTGGCTGCCCTCGCTGCTTCCCGTTGTGCAGCATATAAAGACTCCTCTTCTAGTTTTAACTTCTTCTCTTGTAAGGCTAACTCATTTTGTATTTTGATATCATCAGCCCTCTGGCGTTCCGTAATAGAATCATACTGTTTTTCTTTTAGATCACACAATTCTTCCTCACTCAAGGGTCTTATACTACTGCCAGGACTGTCTCCCTCATCACTTTTCAACAAGTTTTCAAACTCAATTGAAAAATGCTCTCCTCTGGTTGGAGTTTTAAATACTTTGAATCCGCCCCCGGCTCTCTTTAACCGGCTACTCCTCTTTCCTGAAAAGCCTGCAACACCAGTCCCACAAAAACCCCTGGGGGCAAACTTTTTTGTAAAAGTTGGCCTTAATAAAAAACATTGGCTAACAAATTGTTGAAACAAAAAAGTCGTATCAGTCAAAATAAAATCATTAATTTGGAGACCAAAAAAAAAAAAGGACGAGAACTTAAAAAAGCCTTTTGCCCGGGGAGAAGACTGGGAGGGGANAAATAAGGAGGGAGGCAGGGGAGAGGAGAAAGAGGAAGAGGAAAGAGAAAGGNAGAGGGAAGGAGGAAGGGGAAGAAGAAAAGAGGATGAGGGAGAAGGGAGAGGAGGGAGANGAGGGCAGGACAGGGNGAAGAGGAGGGGNNCACCGAACTGAAGGAGAAGANGAGAAANGAAAGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTATTCTGATGCTGAGCAGAC