ORFeome > ap2s1 ORF1 – XORFeome v1.0

ap2s1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ap2s1
Gene ID: 999491
Gene Page ID: 999485
ORF Xenbase ID: 17264403

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078470
Original XGC clone length: 429

Human orthology & disease relationships

NCBI Entrez ID: 1175
Ensembl gene IDs: ENSG00000042753
Directly associated (OMIM) disease MIM numbers: 600740
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: B07

Sequences - 5ʹ (forward) EST

Accession: JZ839689
dbEST ID: 79657391
Trimmed Sequence: ATGATCCGCTTTATCCTGATCCAGAACCGTGCCGGGAAGACTCGCCTGGCCAAGTGGTACATGCAGTTTGATGATGATGAAAAGCAAAAGCTGATTGAGGAGGTTCATGCTGTGGTCACTGTCAGAGATGCCAAGCACACTAATTTTGTGGAGTTTAGGAACTTTAAGATCATATACCGCCGGTATGCTGGGCTGTATTTCTGTATATGTGTGGATGTGACCGACAATAACCTGGCCTATCTGGAAGCCATCCACAACTTTGTAGAGGTGTTAAACGAGTATTTCCATAATGTATGTGAATTAGATCTGGTGTTCAATTTCTACAAGGTATACACAGTGGTGGATGAAATGTTTTTGGCTGGTGAAATTAGAGAAACGAGTCAGACAAAAGTTTTGAAGCAGCTGCTGATGCTTCAGTCCCTGGAGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCCGCTTTATCCTGATCCAGAACCGTGCCGGGAAGACTCGCCTGGCCAAGTGGTACATGCAGTTTGATGATGATGAAAAGCAAAAGCTGATTGAGGAGGTTCATGCTGTGGTCACTGTCAGAGATGCCAAGCACACTAATTTTGTGGAGTTTAGGAACTTTAAGATCATATACCGCCGGTATGCTGGGCTGTATTTCTGTATATGTGTGGATGTGACCGACAATAACCTGGCCTATCTGGAAGCCATCCACAACTTTGTAGAGGTGTTAAACGAGTATTTCCATAATGTATGTGAATTAGATCTGGTGTTCAATTTCTACAAGGTATACACAGTGGTGGATGAAATGTTTTTGGCTGGTGAAATTAGAGAAACGAGTCAGACAAAAGTTTTGAAGCAGCTGCTGATGCTTCAGTCCCTGGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAACAAATAAACAAAGTCTCAAATCTCCTGAATGTTACAGCCCCCNCGGNNGNGNGGGGNGGCCCGCCGCCCCCCCCGCCTGTTCTTGGCTCGTGTTGTGGTGAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAATAATAATGTTGTATGTTGGTGTATATGCGGGGGAGGGGGTTTGGTGGTCCCCCCCTCCTTCCTCCCCCACACCCCTCCCCCGGGTGGGGGGGGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCCGCTTTATCCTGATCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839688
dbEST ID: 79657390
Trimmed Sequence: CTCCAGGGACTGAAGCATCAGCAGCTGCTTCAAAACTTTTGTCTGACTCGTTTCTCTAATTTCACCAGCCAAAAACATTTCATCCACCACTGTGTATACCTTGTAGAAATTGAACACCAGATCTAATTCACATACATTATGGAAATACTCGTTTAACACCTCTACAAAGTTGTGGATGGCTTCCAGATAGGCCAGGTTATTGTCGGTCACATCCACACATATACAGAAATACAGCCCAGCATACCGGCGGTATATGATCTTAAAGTTCCTAAACTCCACAAAATTAGTGTGCTTGGCATCTCTGACAGTGACCACAGCATGAACCTCCTCAATCAGCTTTTGCTTTTCATCATCATCAAACTGCATGTACCACTTGGCCAGGCGAGTCTTCCCGGCACGGTTCTGGATCAGGATAAAGCGGATCATGG
Full Trace Sequence: GGCAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCAGGGACTGAAGCATCAGCAGCTGCTTCAAAACTTTTGTCTGACTCGTTTCTCTAATTTCACCAGCCAAAAACATTTCATCCACCACTGTGTATACCTTGTAGAAATTGAACACCAGATCTAATTCACATACATTATGGAAATACTCGTTTAACACCTCTACAAAGTTGTGGATGGCTTCCAGATAGGCCAGGTTATTGTCGGTCACATCCACACATATACAGAAATACAGCCCAGCATACCGGCGGTATATGATCTTAAAGTTCCTAAACTCCACAAAATTAGTGTGCTTGGCATCTCTGACAGTGACCACAGCATGAACCTCCTCAATCAGCTTTTGCTTTTCATCATCATCAAACTGCATGTACCACTTGGCCAGGCGAGTCTTCCCGGCACGGTTCTGGATCAGGATAAAGCGGATCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCGAGCTAAAAAAAGAAAGTCGTTTTACACGCAAATTAAAGGGGGAGAAGCCCNNGNAAAAAAAAGACGCGGCCCTCCCTACCACTCCCGTGTTGATTGGTTTGGGTGGGAGCACGAAAGAAAGAGCAACGAGCAACAACAAAAAAAACAGAGAGGGATGTGTGTTGTTGAGTGGTAGGNNNNNGGGGGGAGGNNGGCCCCANCCGGCGGGCAAAAAAAAAAAAAAGGGGGCCGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCAGGGACTGAAGCAT