ORFeome > ap3s1 ORF1 – XORFeome v1.0

ap3s1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ap3s1
Gene ID: 948763
Gene Page ID: 948756
ORF Xenbase ID: 17264421

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041251
Original XGC clone length: 582

Human orthology & disease relationships

NCBI Entrez ID: 1176
Ensembl gene IDs: ENSG00000177879
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 203300,208900,608233

Library Location

Plate ID: GDExl11009
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: JZ823765
dbEST ID: 79641467
Trimmed Sequence: ATGATAAAAGCCATCCTCATCTTCAACAACCATGGCAAGCCCCGGCTGTGCAAGTTCTACCAACACTATAGTGAAGATACACAACAACAGATTGTAAGAGAAACATTCCACCTGGTATCCAAAAGAGATGAAAATGTTTGCAATTTCTTAGAAGGAGGCTTATTAATAGGTGGATCTGACAATAAACTCATATATCGGCATTATGCTACTTTATATTTTGTCTTCTGTGTGGATTCTTCAGAAAGTGAACTTGGCATTCTAGATCTTATACAAGTGTTCGTAGAGACTCTGGACAAATGCTTTGAAAATGTCTGTGAGCTGGATTTAATATTCCACGTAGATAAGGTTCACAACATCCTTGCAGAAATGGTGATGGGAGGTATGGTACTAGAAACTAATATGAATGAAATAGTCACTCAAATTGATGCACAGACAAAGCTGGAAAAGTCAGAGGCTGGCCTAGCAGGAGCTCCAGCGCGGGCTGTATCTGCAGTAAAGAATATGAATCTTCCTGAGATGCCAAGAAACATTAACATTGGTGATATCAGTATAAAAGTGCCAAACCTGCCGTCTTTTAAATT
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATAAAAGCCATCCTCATCTTCAACAACCATGGCAAGCCCCGGCTGTGCAAGTTCTACCAACACTATAGTGAAGATACACAACAACAGATTGTAAGAGAAACATTCCACCTGGTATCCAAAAGAGATGAAAATGTTTGCAATTTCTTAGAAGGAGGCTTATTAATAGGTGGATCTGACAATAAACTCATATATCGGCATTATGCTACTTTATATTTTGTCTTCTGTGTGGATTCTTCAGAAAGTGAACTTGGCATTCTAGATCTTATACAAGTGTTCGTAGAGACTCTGGACAAATGCTTTGAAAATGTCTGTGAGCTGGATTTAATATTCCACGTAGATAAGGTTCACAACATCCTTGCAGAAATGGTGATGGGAGGTATGGTACTAGAAACTAATATGAATGAAATAGTCACTCAAATTGATGCACAGACAAAGCTGGAAAAGTCAGAGGCTGGCCTAGCAGGAGCTCCAGCGCGGGCTGTATCTGCAGTAAAGAATATGAATCTTCCTGAGATGCCAAGAAACATTAACATTGGTGATATCAGTATAAAAGTGCCAAACCTGCCGTCTTTTAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCAGTCCAGCTGATATCCCCTATAAGTGAGTCGTATTACATGGTCATAGCTGTTCCTGCAGCTCTGCTCCAACCTCACCACCTTAATAAAAAAAAAAAAAAAAAAAAAAAACNNNN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATAAAAGCCATCCTCATCTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829074
dbEST ID: 79646776
Trimmed Sequence: TTTAAAAGACGGCAGGTTTGGCACTTTTATACTGATATCACCAATGTTAATGTTTCTTGGCATCTCAGGAAGATTCATATTCTTTACTGCAGATACAGCCCGCGCTGGAGCTCCTGCTAGGCCAGCCTCTGACTTTTCCAGCTTTGTCTGTGCATCAATTTGAGTGACTATTTCATTCATATTAGTTTCTAGTACCATACCTCCCATCACCATTTCTGCAAGGATGTTGTGAACCTTATCTACGTGGAATATTAAATCCAGCTCACAGACATTTTCAAAGCATTTGTCCAGAGTCTCTACGAACACTTGTATAAGATCTAGAATGCCAAGTTCACTTTCTGAAGAATCCACACAGAAGACAAAATATAAAGTAGCATAATGCCGATATATGAGTTTATTGTCAGATCCACCTATTAATAAGCCTCCTTCTAAGAAATTGCAAACATTTTCATCTCTTTTGGATACCAGGTGGAATGTTTCTCTTACAATCTGTTGTTGTGTATCTTCACTATAGTGTTGGTAGAACTTGCACAGCCGGGGCTTGCCATGGTTGTTGAAGATGAAGATGGCTTTTATCATGG
Full Trace Sequence: GCTGCCGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTAAAAGACGGCAGGTTTGGCACTTTTATACTGATATCACCAATGTTAATGTTTCTTGGCATCTCAGGAAGATTCATATTCTTTACTGCAGATACAGCCCGCGCTGGAGCTCCTGCTAGGCCAGCCTCTGACTTTTCCAGCTTTGTCTGTGCATCAATTTGAGTGACTATTTCATTCATATTAGTTTCTAGTACCATACCTCCCATCACCATTTCTGCAAGGATGTTGTGAACCTTATCTACGTGGAATATTAAATCCAGCTCACAGACATTTTCAAAGCATTTGTCCAGAGTCTCTACGAACACTTGTATAAGATCTAGAATGCCAAGTTCACTTTCTGAAGAATCCACACAGAAGACAAAATATAAAGTAGCATAATGCCGATATATGAGTTTATTGTCAGATCCACCTATTAATAAGCCTCCTTCTAAGAAATTGCAAACATTTTCATCTCTTTTGGATACCAGGTGGAATGTTTCTCTTACAATCTGTTGTTGTGTATCTTCACTATAGTGTTGGTAGAACTTGCACAGCCGGGGCTTGCCATGGTTGTTGAAGATGAAGATGGCTTTTATCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTTATAGTCAAAATAAAATCATTATTTAGGAGGCCCGAGCTTAAAAACTGGGCGACGTTAAAAACCCCCCACCGGCTGCTCTTGGGGAGAAATTTTCTCGGGGGAAAATCATTGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTAAAAGACGGCAGGTTTGG