ORFeome > api5 ORF1 – XORFeome v1.0

api5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: api5
Gene ID: 963042
Gene Page ID: 963037
ORF Xenbase ID: 17264493

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043906
Original XGC clone length: 1572

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ824045
dbEST ID: 79641747
Trimmed Sequence: ATGCCCACCGTGGAGGAGCTCTACCGGAACTACGGAATACTGGCAGACGCCAAGGACGATGTCGGGCAGCACAAAAGTGCCTATCAGGTCATCCTCGATGGAGTAAAGGGAGGACCGAAAGAAAAGCGGCTCGCTGCCCAGTTTATCCCGAAATTCTTCAAGCATTTCCCTGACCTGTCAGATGCAGCACTCAATGCCCAGCTTGATCTGTGTGAAGATGAGGATGTTTCTATCCGTCGGCAGGCAATAAAAGAACTGTCACAATTTGCCACCGGAGAGAACCTTCCTCGTGTAGCAGATATTCTTACGCAGCTTCTGCAGTCAGATGACTCTGCCGAATTCAACCTGGTGAACAACGCTCTGCTGAGCATATTTAAAATGGACGCTAAAGGGACCTTGGGAGGCCTTTTTAGCCAGATTCTTCAAGGAGAAGATGTTGTACGGGAGAGAGCCATCAAATTCCTGGCCACCAAGATGAAAACGCTTCCAGAGGATATCCTGACAAAAGAAGTGGACGATTACATATTCTCTGAGTCTAAAAAGGTTCTGTATGATGTCACTGGAGAAGAGTTTGTTTTGTTCATGAAGATCCTGTCGGCGCTGAAGAACTTGCAGACAGTCAGTGGCAGACAGCAGCTGGTGGATTTGGTCTCTGAGCAGGCGGGGCTGCATCAAACGCTAAACCCTGCAGATCCCGACTCTGTAGATCGACTGCTCCAGTGCATGCGGCAGGCCGTGCCTTTGNNTTTCCNAGAATGTCCACTCCACCAAATTTCNTGACCTATTTTCGGTGAGCCAAGTGCTTCCCATCCTGGAACCCTTTCCCCCAGC
Full Trace Sequence: CAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCACCGTGGAGGAGCTCTACCGGAACTACGGAATACTGGCAGACGCCAAGGACGATGTCGGGCAGCACAAAAGTGCCTATCAGGTCATCCTCGATGGAGTAAAGGGAGGACCGAAAGAAAAGCGGCTCGCTGCCCAGTTTATCCCGAAATTCTTCAAGCATTTCCCTGACCTGTCAGATGCAGCACTCAATGCCCAGCTTGATCTGTGTGAAGATGAGGATGTTTCTATCCGTCGGCAGGCAATAAAAGAACTGTCACAATTTGCCACCGGAGAGAACCTTCCTCGTGTAGCAGATATTCTTACGCAGCTTCTGCAGTCAGATGACTCTGCCGAATTCAACCTGGTGAACAACGCTCTGCTGAGCATATTTAAAATGGACGCTAAAGGGACCTTGGGAGGCCTTTTTAGCCAGATTCTTCAAGGAGAAGATGTTGTACGGGAGAGAGCCATCAAATTCCTGGCCACCAAGATGAAAACGCTTCCAGAGGATATCCTGACAAAAGAAGTGGACGATTACATATTCTCTGAGTCTAAAAAGGTTCTGTATGATGTCACTGGAGAAGAGTTTGTTTTGTTCATGAAGATCCTGTCGGCGCTGAAGAACTTGCAGACAGTCAGTGGCAGACAGCAGCTGGTGGATTTGGTCTCTGAGCAGGCGGGGCTGCATCAAACGCTAAACCCTGCAGATCCCGACTCTGTAGATCGACTGCTCCAGTGCATGCGGCAGGCCGTGCCTTTGNNTTTCCNAGAATGTCCACTCCACCAAATTTCNTGACCTATTTTCGGTGAGCCAAGTGCTTCCCATCCTGGAACCCTTTCCCCCAGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCACCGTGGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829355
dbEST ID: 79647057
Trimmed Sequence: GTAAATCCTTCCTCTGCTGCGGTTACCACGTCCTCCCCATCCCCTGCCTCTGCCCCCCTGGAATCCACCGCGCTGCTCATAGGAGAAAGCTCCCACATTGCCACTGTATTTGCCGCTGGGAGGGTTGTAGATCTGCCTGGAGTCTCTTTTTGGTCCCACTACTGGTTTTTTGGGTGGTGAAGTAGATGAAGTCTCATCACTCATTCTCTTTTGCCCTGAATCAGTCTTCTGGACTGGTTTCCAGGACAACGTCACTGTGCTCTTGTAGGAGGGAGGATTGTGGAACAGGTCCTTAATTAATACGTTGATGTTGTTGGTTATTTTCAGAGCAACGACTTTAATTTTGTTCTCTTCTGTTTTCAGAGCATCTCCAGATTTTCCCTGAAGGGTGAGGCGGAGCTGACGAATATAGACTTGGAGACCCCGAGCAAAATACTGTAACCTGATTTTGAAGTCTTTTAGCTTCTCTGCGTCAACTTTAGCAATAAGGAAGTCCGGCAACTTTCTCCCGAGCTGGTGGAAACTGAACAGTAAACATTCAACGTAGCTAAACTGAAGTTTGGGCTCTTCATTGGCAGCGCTGTCCCCATTCTCAACCTCTTCAGGAGGAAGTGGCATGAATTTCAGCAACTTGTCCAAAAATTTGGTCAGATGGGATTCCAGTTTATCCAGGTCGCCCACGAAAGGAGCTCAATTTCACCCAGAAACTTTAAAAACCTCCTGGCTGGAACATCAATGGCCCTTCAACCTTGGGGCGGGGTA
Full Trace Sequence: CCGAGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAAATCCTTCCTCTGCTGCGGTTACCACGTCCTCCCCATCCCCTGCCTCTGCCCCCCTGGAATCCACCGCGCTGCTCATAGGAGAAAGCTCCCACATTGCCACTGTATTTGCCGCTGGGAGGGTTGTAGATCTGCCTGGAGTCTCTTTTTGGTCCCACTACTGGTTTTTTGGGTGGTGAAGTAGATGAAGTCTCATCACTCATTCTCTTTTGCCCTGAATCAGTCTTCTGGACTGGTTTCCAGGACAACGTCACTGTGCTCTTGTAGGAGGGAGGATTGTGGAACAGGTCCTTAATTAATACGTTGATGTTGTTGGTTATTTTCAGAGCAACGACTTTAATTTTGTTCTCTTCTGTTTTCAGAGCATCTCCAGATTTTCCCTGAAGGGTGAGGCGGAGCTGACGAATATAGACTTGGAGACCCCGAGCAAAATACTGTAACCTGATTTTGAAGTCTTTTAGCTTCTCTGCGTCAACTTTAGCAATAAGGAAGTCCGGCAACTTTCTCCCGAGCTGGTGGAAACTGAACAGTAAACATTCAACGTAGCTAAACTGAAGTTTGGGCTCTTCATTGGCAGCGCTGTCCCCATTCTCAACCTCTTCAGGAGGAAGTGGCATGAATTTCAGCAACTTGTCCAAAAATTTGGTCAGATGGGATTCCAGTTTATCCAGGTCGCCCACGAAAGGAGCTCAATTTCACCCAGAAACTTTAAAAACCTCCTGGCTGGAACATCAATGGCCCTTCAACCTTGGGGCGGGGTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAATCCTTCCTCTGCTGCGGT