ORFeome > aplnr ORF3 – XORFeome v1.0

aplnr ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aplnr
Gene ID: 6254056
Gene Page ID: 6456076
ORF Xenbase ID: 17264529

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC139486
Original XGC clone length: 1062

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ838767
dbEST ID: 79656469
Trimmed Sequence: ATGGAAACAGAAGGCTTGAGCCCTATGCTATACGAAGACGACTATTATTACGGAAATGAGACTGGACTACAACCATGCGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGTCCAAGCCAAAGCGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACACTGCCTCTATGGGCCACATACACTGCTCTAGGCTTTCACTGGCCCTTTGGTTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAACATGTTTGCCAGTGTTTTTTGCCTGACCTGCCTCAGTTTTGATCGGTACCTGGCCATTGTCCATTCGCTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCATTGTATCCTTGGCTGTTATTTGGCTCTTCTCAGGGCTTTTAGCACTCCCAAGTCTGATTCTGCGTGACACACGTGTAGAAGGCAATAACACTATCTGTGACCTGGACTTCAGTTGTTGTTTCTGCAAGGAAAAATGAAATTTCTGGATCGGGGGGGCTAGCCTTTTTACCACAGTTCCAAGGATTCCTGCTGCCCCTGCCCCTTTTGACCATCTTTTACTGGTTCATCCGGTGCCAAGGGGACCGTGCCTTTCAAAAACCTTATAAAAAAATAAACAAAAAAAAAAAAAGGCTTCTTTAAATATTTTTTTTTCCCTGTTTTTTATGGTTTTGTTTATTTTGCGTTGGTGTCCCTTTTCCCGTTATCGTG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAACAGAAGGCTTGAGCCCTATGCTATACGAAGACGACTATTATTACGGAAATGAGACTGGACTACAACCATGCGATGAAACAGACTGGGATTTCTCCTATTCTCTGCTACCTGTCTTTTACATGATCGTGTTTGTCCTTGGACTCTCAGGGAATGGAGTGGTCATCTTTACAGTATGGAAGTCCAAGCCAAAGCGGAGATCTGCAGACACCTACATAGGTAATCTAGCACTGGCTGACCTGGCCTTTGTGGTAACACTGCCTCTATGGGCCACATACACTGCTCTAGGCTTTCACTGGCCCTTTGGTTCTGCACTGTGCAAGCTCAGCAGCTATCTGGTCTTGCTTAACATGTTTGCCAGTGTTTTTTGCCTGACCTGCCTCAGTTTTGATCGGTACCTGGCCATTGTCCATTCGCTTTCCAGTGCTAAACTTCGCTCCCGCTCCTCCATCATTGTATCCTTGGCTGTTATTTGGCTCTTCTCAGGGCTTTTAGCACTCCCAAGTCTGATTCTGCGTGACACACGTGTAGAAGGCAATAACACTATCTGTGACCTGGACTTCAGTTGTTGTTTCTGCAAGGAAAAATGAAATTTCTGGATCGGGGGGGCTAGCCTTTTTACCACAGTTCCAAGGATTCCTGCTGCCCCTGCCCCTTTTGACCATCTTTTACTGGTTCATCCGGTGCCAAGGGGACCGTGCCTTTCAAAAACCTTATAAAAAAATAAACAAAAAAAAAAAAAGGCTTCTTTAAATATTTTTTTTTCCCTGTTTTTTATGGTTTTGTTTATTTTGCGTTGGTGTCCCTTTTCCCGTTATCGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAACAGAAGGCTTGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838766
dbEST ID: 79656468
Trimmed Sequence: GATTTTTGAGTCTGTGCACTTAAACTGGAAGATGTGTTGCTGAGGTGTCCTTGGAGGACTTTTTTGAAACCAAAAAAAAAAAAACATTGGGAGCGAAATCCCAAGTCAAAAAAGGCATAAAGGAAAGGGTTTAAGCAGCTATTAACGTATGCCAAGCAGGTGGCATAGGGGTGCAGGCTGACAATGATGTTTTGTGTAAAGCAAGAAAGTTCCAGGAAGCCCATGAGGTCTAAAAAGTGAATGGTTTTCAAAATATGGAAAGGCAGCCAGCAAATAGCAAACACTACAACCAGCGTAATAATAATCTTAAAAAGCCTCTTTTTCTTCTGTTCTTCCTTCTTTAGGTTTTGGAAATGCATGGTCACCTTGCCACCGATGAAGCAGTAAAAGATGGTCATAAGGAGCAGGGGCAGCAGGAATCCTGGAACTGTGGTAAGAATGCTTACCCCCCCAATCCAGAAATTTTCATTCTCCTTGCTTGAGACACCACTGAAGTCCAGGTCACAAATAGTGTTATTGCCTTCTACCCGTGTGTCACGCAAAACCAAACTTGGGAATGCTAAAACCCCTGAAAAAAGCCAATTAACACCAAGGGTAAATGGAGGGAGGAGCGGGGAGCAAATTTTAACACTGGAAAGCGAAAGGGGACATGGCCGGGTTCCCATCAAAAACGGAGCAGGGTTCGGGCAAAAAAACTTGGGCAAAATGTTTAAACCAAGAACCAAATAATCTCTTGAAAATTTTTCAAGGTGTCAAAAAACCAAGGGGGGCCGCTG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATTTTTGAGTCTGTGCACTTAAACTGGAAGATGTGTTGCTGAGGTGTCCTTGGAGGACTTTTTTGAAACCAAAAAAAAAAAAACATTGGGAGCGAAATCCCAAGTCAAAAAAGGCATAAAGGAAAGGGTTTAAGCAGCTATTAACGTATGCCAAGCAGGTGGCATAGGGGTGCAGGCTGACAATGATGTTTTGTGTAAAGCAAGAAAGTTCCAGGAAGCCCATGAGGTCTAAAAAGTGAATGGTTTTCAAAATATGGAAAGGCAGCCAGCAAATAGCAAACACTACAACCAGCGTAATAATAATCTTAAAAAGCCTCTTTTTCTTCTGTTCTTCCTTCTTTAGGTTTTGGAAATGCATGGTCACCTTGCCACCGATGAAGCAGTAAAAGATGGTCATAAGGAGCAGGGGCAGCAGGAATCCTGGAACTGTGGTAAGAATGCTTACCCCCCCAATCCAGAAATTTTCATTCTCCTTGCTTGAGACACCACTGAAGTCCAGGTCACAAATAGTGTTATTGCCTTCTACCCGTGTGTCACGCAAAACCAAACTTGGGAATGCTAAAACCCCTGAAAAAAGCCAATTAACACCAAGGGTAAATGGAGGGAGGAGCGGGGAGCAAATTTTAACACTGGAAAGCGAAAGGGGACATGGCCGGGTTCCCATCAAAAACGGAGCAGGGTTCGGGCAAAAAAACTTGGGCAAAATGTTTAAACCAAGAACCAAATAATCTCTTGAAAATTTTTCAAGGTGTCAAAAAACCAAGGGGGGCCGCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATTTTTGAGTCTGTGCACTTAAA