ORFeome > apoa1 ORF1 – XORFeome v1.0

apoa1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: apoa1
Gene ID: 962597
Gene Page ID: 962590
ORF Xenbase ID: 17264553

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053783
Original XGC clone length: 783

Human orthology & disease relationships

NCBI Entrez ID: 335
Ensembl gene IDs: ENSG00000118137
Directly associated (OMIM) disease MIM numbers: 105200,604091
Indirectly associated (Lage, et al.) disease MIM numbers: 105200,144010,205400,604091

Library Location

Plate ID: GDExl11001
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ839110
dbEST ID: 79656812
Trimmed Sequence: ATGAAGAGCCTAGTCCTACTAGCAGTACTGTTCCTTTCAGGAACACAGGCAAATTACTTCCCTTGGCAACACGATGAGCCCCGCACTCCAGTTCAGCAGGTACGGGAGGTTTTAGAGAGCTACGTACACAAAGTTCGTGACTTGGGAAGAGAAGCTGTGAGCCAACTGGAGACCTCTGATCTTGGAAAACAACTTGACTTGAAGATCACTGAGAAACTTGACACCTTTGGTACCAATGCTATGAACCTGAGGAAGCAAATCAATCCCTATGTAGAGAATATCAGGGAACAGGTGTCCAAAGAGCTAGAAAAGGAACTCCCAATAATCAAGGAGAAAATCCGCCCCATCCTGGAAGGCTTTCAGAAACGTTGGGCTGAAGATGCAAAGGCTTACCAGGAGAAAATCTCGCCCCTGGTAGCTGAGCTACAAAAGCAAACCAAGAGCAACCTGGATTCCTTGTATAAAAAGATCACTCCCATTGCTGAAGAAGTTCGGGACAAAGTGAGAGTGGATGTTGACGCCCTTCGCTCAAGACTCACACCCTACAGTGATGAGATCAGGCAAAAGCTGGTTGCGAAACTGGAAGAGCTTAAGGCCAATGCAGGGTCCAAATCTGAGGAATACAGAAACCAACTGTCACAGTACCTTTGAGAATGGCAAGGAGAAATATGGAACCCCGGGCCCCGAAGCATTCGGGAAACTTCTGGTGCCCCCGGGCGAAAGAAACCCAAAAACCAACTTGGGCAAAAAATTTTGGAAAAACCCGGAAAGCCAAAAACCCAAAAAAGGGAAAGCCCCTGGCCCAACCTT
Full Trace Sequence: CTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGAGCCTAGTCCTACTAGCAGTACTGTTCCTTTCAGGAACACAGGCAAATTACTTCCCTTGGCAACACGATGAGCCCCGCACTCCAGTTCAGCAGGTACGGGAGGTTTTAGAGAGCTACGTACACAAAGTTCGTGACTTGGGAAGAGAAGCTGTGAGCCAACTGGAGACCTCTGATCTTGGAAAACAACTTGACTTGAAGATCACTGAGAAACTTGACACCTTTGGTACCAATGCTATGAACCTGAGGAAGCAAATCAATCCCTATGTAGAGAATATCAGGGAACAGGTGTCCAAAGAGCTAGAAAAGGAACTCCCAATAATCAAGGAGAAAATCCGCCCCATCCTGGAAGGCTTTCAGAAACGTTGGGCTGAAGATGCAAAGGCTTACCAGGAGAAAATCTCGCCCCTGGTAGCTGAGCTACAAAAGCAAACCAAGAGCAACCTGGATTCCTTGTATAAAAAGATCACTCCCATTGCTGAAGAAGTTCGGGACAAAGTGAGAGTGGATGTTGACGCCCTTCGCTCAAGACTCACACCCTACAGTGATGAGATCAGGCAAAAGCTGGTTGCGAAACTGGAAGAGCTTAAGGCCAATGCAGGGTCCAAATCTGAGGAATACAGAAACCAACTGTCACAGTACCTTTGAGAATGGCAAGGAGAAATATGGAACCCCGGGCCCCGAAGCATTCGGGAAACTTCTGGTGCCCCCGGGCGAAAGAAACCCAAAAACCAACTTGGGCAAAAAATTTTGGAAAAACCCGGAAAGCCAAAAACCCAAAAAAGGGAAAGCCCCTGGCCCAACCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGAGCCTAGTCCTAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839109
dbEST ID: 79656811
Trimmed Sequence: GGCATCCTGTCTGAGTCTAGCTTTCAGATTTTCCCAAATCTTTGCCAAGTTGCTTCTGGCTTCCTCTGCATGGGGCACCAGACGTTCCCGAATGCTCTGGGCCAGGGGTCCATACTTCTCCTTGACATTCTCAATGTACTGTGACAGTTGGGTTCTGTATTCCTCAGATTTTGGACCTGCATTGGCCTTAAGCTCTTCCAGTTTCGCAACCAGCTTTTGCCTGATCTCATCACTGTAGGGTGTGAGTCTTGAGCGAAGGGCGTCAACATCCACTCTCACTTTGTCCCGAACTTCTTCAGCAATGGGAGTGATCTTTTTATACAAGGAATCCAGGTTGCTCTTGGTTTGCTTTTGTAGCTCAGCTACCAGGGGCGAGATTTTCTCCTGGTAAGCCTTTGCATCTTCAGCCCAACGTTTCTGAAAGCCTTCCAGGATGGGGCGGATTTTCTCCTTGATTATTGGGAGTTCCTTTTCTAGCTCTTTGGACACCTGTTCCCTGATATTCTCTACATAGGGATTGATTTGCTTCCTCAGGTTCATAGCATTGGTACCAAAGGTGTCAAGTTTCTCAGTGATCTCCCAGTCAAGTTGTTTTCCCAAATCAAAAGTCCTCCGTTGGCCTCCAGCCTCCTCTTCCCAAGTCCCGAACTTTTGGGTACTTATCTTCTCAAAAACCTCCCCGTAACCTCCTGAAAATGGAAGTGGCGGGGGCTCAGCGTGGGTGGCCAAAGGGAAAGAGAATTTCGCCCGTTTTTTCCTCGAAAAGGGAAAAAAAT
Full Trace Sequence: GAGAAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCATCCTGTCTGAGTCTAGCTTTCAGATTTTCCCAAATCTTTGCCAAGTTGCTTCTGGCTTCCTCTGCATGGGGCACCAGACGTTCCCGAATGCTCTGGGCCAGGGGTCCATACTTCTCCTTGACATTCTCAATGTACTGTGACAGTTGGGTTCTGTATTCCTCAGATTTTGGACCTGCATTGGCCTTAAGCTCTTCCAGTTTCGCAACCAGCTTTTGCCTGATCTCATCACTGTAGGGTGTGAGTCTTGAGCGAAGGGCGTCAACATCCACTCTCACTTTGTCCCGAACTTCTTCAGCAATGGGAGTGATCTTTTTATACAAGGAATCCAGGTTGCTCTTGGTTTGCTTTTGTAGCTCAGCTACCAGGGGCGAGATTTTCTCCTGGTAAGCCTTTGCATCTTCAGCCCAACGTTTCTGAAAGCCTTCCAGGATGGGGCGGATTTTCTCCTTGATTATTGGGAGTTCCTTTTCTAGCTCTTTGGACACCTGTTCCCTGATATTCTCTACATAGGGATTGATTTGCTTCCTCAGGTTCATAGCATTGGTACCAAAGGTGTCAAGTTTCTCAGTGATCTCCCAGTCAAGTTGTTTTCCCAAATCAAAAGTCCTCCGTTGGCCTCCAGCCTCCTCTTCCCAAGTCCCGAACTTTTGGGTACTTATCTTCTCAAAAACCTCCCCGTAACCTCCTGAAAATGGAAGTGGCGGGGGCTCAGCGTGGGTGGCCAAAGGGAAAGAGAATTTCGCCCGTTTTTTCCTCGAAAAGGGAAAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCATCCTGTCTGAGTCTA