ORFeome > apob ORF1 – XORFeome v1.0

apob ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: apob
Gene ID: 5872781
Gene Page ID: 5872779
ORF Xenbase ID: 17264565

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054229
Original XGC clone length: 1314

Human orthology & disease relationships

NCBI Entrez ID: 338
Ensembl gene IDs: ENSG00000084674
Directly associated (OMIM) disease MIM numbers: 144010,615558
Indirectly associated (Lage, et al.) disease MIM numbers: 105200,144010,205400,604091

Library Location

Plate ID: GDExl11002
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ839283
dbEST ID: 79656985
Trimmed Sequence: ATGGGCAACGAGAAGCTGTTGCTCCTACTTTTGCTAGCCAGTGCCTTTGCTCAGGAAGATGGGTCAGACTCTCAGGATTCAACCTGTTCAAAAGCTGCTTTAAAATTCAAGCCTTTAAGGAAATATGTCTACAACTATGAAGCTGCAACTACAAGTGGAGTGTCTGGTACAGCGGACTCCCAAAGTGGATCCAAATTCAGCTGCAAGATTGAATTGGAGGTTCCTCAGCCATGCAACTTTATCCTACGGGTCAAGCAATGCACCCTGCGAGAGGTGTATGGGGTCAGTTCCGAGGGCAAAGCTCTTCTAAAGAAGTCCAAGAACTCCGATGACTTCTCCAACGCTATGACCAAGTATGAGGTTAAGGTCGCTGTACAAGACGGGAAGAATGTTGTTCTGTACCCAGACCAAGATGAAACTCTCACTGTATTAAACATGAAGAGGGGGATCCTTTCTGCTCTGCTTGGTCCTGATGAAACCCAGGAAACAGATTATGTGGATACTGTGTATGGAAAATGTACCAGTGAGATTAAAGTCACAAGCCGAAAGGGTAACACACCAACAGATGTTACGGTGGGAGAGGAATCTGAAGACCTGTGACAAGTTTACACCAATCAGAGATTATGTCAGCCCCCTCGCAATCCTTAAAGGCCTGAATACCCCATTGTCTACACTGATCAGCAGCAGTCAGGTCTGTCAGTACAGCAGGAATTCCAAAAAGAAGCACATCAAAGAAGGCTCCAGGGGTTGAAACTCACATTTTCCCTTCCCTTTCCCCACAAAAAATCCATTTAGGGCCATGAAAAAACCCAAAGTC
Full Trace Sequence: GCGGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCAACGAGAAGCTGTTGCTCCTACTTTTGCTAGCCAGTGCCTTTGCTCAGGAAGATGGGTCAGACTCTCAGGATTCAACCTGTTCAAAAGCTGCTTTAAAATTCAAGCCTTTAAGGAAATATGTCTACAACTATGAAGCTGCAACTACAAGTGGAGTGTCTGGTACAGCGGACTCCCAAAGTGGATCCAAATTCAGCTGCAAGATTGAATTGGAGGTTCCTCAGCCATGCAACTTTATCCTACGGGTCAAGCAATGCACCCTGCGAGAGGTGTATGGGGTCAGTTCCGAGGGCAAAGCTCTTCTAAAGAAGTCCAAGAACTCCGATGACTTCTCCAACGCTATGACCAAGTATGAGGTTAAGGTCGCTGTACAAGACGGGAAGAATGTTGTTCTGTACCCAGACCAAGATGAAACTCTCACTGTATTAAACATGAAGAGGGGGATCCTTTCTGCTCTGCTTGGTCCTGATGAAACCCAGGAAACAGATTATGTGGATACTGTGTATGGAAAATGTACCAGTGAGATTAAAGTCACAAGCCGAAAGGGTAACACACCAACAGATGTTACGGTGGGAGAGGAATCTGAAGACCTGTGACAAGTTTACACCAATCAGAGATTATGTCAGCCCCCTCGCAATCCTTAAAGGCCTGAATACCCCATTGTCTACACTGATCAGCAGCAGTCAGGTCTGTCAGTACAGCAGGAATTCCAAAAAGAAGCACATCAAAGAAGGCTCCAGGGGTTGAAACTCACATTTTCCCTTCCCTTTCCCCACAAAAAATCCATTTAGGGCCATGAAAAAACCCAAAGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCAACGAGAAGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839282
dbEST ID: 79656984
Trimmed Sequence: CTTGCTGACGGCGTGACTTAATGCATAAAATGAAGCTCTGCTTGACTGATACTGGGCCATGTTGAGAAGTTCCCGTACACGTTTTGTGCATGGAGAAGGTAACAGGCCCAAGCCGTAAGTAACTGTGTCGCTTATGACTGGGGATATGTCTCCACTTCTGAGCACCTGAAGGATACCGCCAAAGCATTCAGGGGTCCCACACTGAGTCAACGCTTGAAGAGCAATAGGGCTTGACAGCTGCATTAGCCTTGGAACAAGAGGTCCTAGTGAGTCGTTATTTAGACCCCTTAAGGCTGTCACAAGTTTGTAGAAGCGGTTGGCTCTCTGCTGGTTCTGCTCTGTCGTAGACAGTTTCTGTAACTCCTGTAGATGTTCCAATGCAGCCTCTTCATTTTTGGATGGTGTTTTTGTAGCATCCATAGCAAGGCCTCGTGCCACGCTGGGATCTGGATCAAAATCTCTGCTGTTGGTCTTAGTCACTTCTTCCAGCTTCAGTGTCTGAGTGACTTTGCTATTCATGCCATACTGATTCTTGTGTGAGAAGGGAANGAAAATGTGAGTTTCAACACATGATGCCTCTGTGATGTGCCTCCTCTTGAAATCCATGCTGTACTGACAGACCTGACTGCTGCTGATCAGTGTAAAAAATGGGGGTAATCCAGGCCTTTTAAGAATGCCAAGGGGGCCTGAACTTAATCCTCCTAATTTGGTGTAAAACTTTGTCCAAAGGGTCTTTCCAAATTTCCTCCCCCCACCCCAA
Full Trace Sequence: GGGGAAACTGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTGCTGACGGCGTGACTTAATGCATAAAATGAAGCTCTGCTTGACTGATACTGGGCCATGTTGAGAAGTTCCCGTACACGTTTTGTGCATGGAGAAGGTAACAGGCCCAAGCCGTAAGTAACTGTGTCGCTTATGACTGGGGATATGTCTCCACTTCTGAGCACCTGAAGGATACCGCCAAAGCATTCAGGGGTCCCACACTGAGTCAACGCTTGAAGAGCAATAGGGCTTGACAGCTGCATTAGCCTTGGAACAAGAGGTCCTAGTGAGTCGTTATTTAGACCCCTTAAGGCTGTCACAAGTTTGTAGAAGCGGTTGGCTCTCTGCTGGTTCTGCTCTGTCGTAGACAGTTTCTGTAACTCCTGTAGATGTTCCAATGCAGCCTCTTCATTTTTGGATGGTGTTTTTGTAGCATCCATAGCAAGGCCTCGTGCCACGCTGGGATCTGGATCAAAATCTCTGCTGTTGGTCTTAGTCACTTCTTCCAGCTTCAGTGTCTGAGTGACTTTGCTATTCATGCCATACTGATTCTTGTGTGAGAAGGGAANGAAAATGTGAGTTTCAACACATGATGCCTCTGTGATGTGCCTCCTCTTGAAATCCATGCTGTACTGACAGACCTGACTGCTGCTGATCAGTGTAAAAAATGGGGGTAATCCAGGCCTTTTAAGAATGCCAAGGGGGCCTGAACTTAATCCTCCTAATTTGGTGTAAAACTTTGTCCAAAGGGTCTTTCCAAATTTCCTCCCCCCACCCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGCTGACGGCGTGACT