ORFeome > aqp12a ORF1 – XORFeome v1.0

aqp12a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: aqp12a
Gene ID: 865475
Gene Page ID: 481662
ORF Xenbase ID: 17264619

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082904
Original XGC clone length: 963

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ839604
dbEST ID: 79657306
Trimmed Sequence: ATGGCTGGACTCAACATCTTGGTGGCTTTCTTTGCATCAACCGTAGCCCTGTGCCAGCTTCTTCGCTGGGCTAGCAGAAGGTTCCTGCCTGATCGGCTCTATCAGTGCACGGCCAGTGAGTTGGCCAGTTCATTTCAGTTATGTGCTTGCTGTCTGGAGCTGCGGATGCTGCTGGAAATTGGTATGTGGGGAGGTGGATATGGCCCTGATGTAGTCACAACACTGCTGTTTCTTCTGTTCGTTGCCCATGGATTCACTTTTAATAAAGCATCAGGCAACTCCGCAGTGTCACTGCAGGATTTCCTTCTCCGTGACTCTCCTCTTTTAGACACTGTGGCTAAGTTACTGGCACAGTACATGGGCATGGAAGCTGCAAAAGTTCTAACGAAACAATACTGGGCATTGGAGCTCACAGAATTCCACATGATTCAGAATCTGATGGCTCAGGACTGCAGCTCGTCTCTGCAAACCTCCGTTGCTCATGGCGTCTTTGTTGAAGGATTGTGCGCTCTCTGCTTCCATTTGGTGATCCTTCGCTTCAAGAGCACAAGGCTGATCTACAGGGTTCCTATAGTTGCACTTACTGTGTCTCTCCTGTCTTACACCGCTGGATCGTACACTGGAGCTTTCTTTAACCCCACTCCTGGCGGCCGCACTGACCTTTCCAATGCTTCTGGAAACACCCCTGACGAAAAATTCACTTGGTGTATTGCGGTGGGCCCTTTGACGGGGCATGGTGGCTGGGCCCCTCTTTCTGTATTCAAGGCAACCATCCCCCCCTGCTTCTTTTCAAAAAAAAACCCTGGCTGGAAACTCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGACTCAACATCTTGGTGGCTTTCTTTGCATCAACCGTAGCCCTGTGCCAGCTTCTTCGCTGGGCTAGCAGAAGGTTCCTGCCTGATCGGCTCTATCAGTGCACGGCCAGTGAGTTGGCCAGTTCATTTCAGTTATGTGCTTGCTGTCTGGAGCTGCGGATGCTGCTGGAAATTGGTATGTGGGGAGGTGGATATGGCCCTGATGTAGTCACAACACTGCTGTTTCTTCTGTTCGTTGCCCATGGATTCACTTTTAATAAAGCATCAGGCAACTCCGCAGTGTCACTGCAGGATTTCCTTCTCCGTGACTCTCCTCTTTTAGACACTGTGGCTAAGTTACTGGCACAGTACATGGGCATGGAAGCTGCAAAAGTTCTAACGAAACAATACTGGGCATTGGAGCTCACAGAATTCCACATGATTCAGAATCTGATGGCTCAGGACTGCAGCTCGTCTCTGCAAACCTCCGTTGCTCATGGCGTCTTTGTTGAAGGATTGTGCGCTCTCTGCTTCCATTTGGTGATCCTTCGCTTCAAGAGCACAAGGCTGATCTACAGGGTTCCTATAGTTGCACTTACTGTGTCTCTCCTGTCTTACACCGCTGGATCGTACACTGGAGCTTTCTTTAACCCCACTCCTGGCGGCCGCACTGACCTTTCCAATGCTTCTGGAAACACCCCTGACGAAAAATTCACTTGGTGTATTGCGGTGGGCCCTTTGACGGGGCATGGTGGCTGGGCCCCTCTTTCTGTATTCAAGGCAACCATCCCCCCCTGCTTCTTTTCAAAAAAAAACCCTGGCTGGAAACTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGACTCAACATCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839603
dbEST ID: 79657305
Trimmed Sequence: GCTGCTTCGTTTCTGAGCTGGTAAAGTCGCTGCTTTCCTAGACACATCTGGCGCAGCTTTCTTCTCAGGTGCTTTTCTCTTTTGAGGAGATTTGAGATTATCTGAAGCTTTTGCTGTAGAGGCTTGAAGGGCTTTTGTCTTTGGAGTTTTGTATTTGCCCTTCTGGGAGTACAGCAGGTTTCTCTGAAAGAGCAGGGGGATGTTGCCTTGATACAGAAAGAGGGCCAGCACCATGCCAGTCAAAGGGCCACAGCAATACACCAGTGAATATTCTGTCAGGGTGTTCCCAGAGCATTGGAAGGTCAGTGCGGCCGCCAGAGTGGGGTTAAAGAAAGCTCCAGTGTACGATCCAGCGGTGTAAGACAGGAGAGACACAGTAAGTGCAACTATAGGAACCCTGTAGATCAGCCTTGTGCTCTTGAAGCGAAGGATCACCAAATGGAAGCAGAGAGCGCACAATCCTTCAACAAAGACGCCATGAGCAACGGAGGTTTGCAGAGACGAGCTGCAGTCCTGAGCCATCAGATTCTGAATCATGTGGAATTCTGTGAGCTCCAATGCCCAGTATTGTTTCGTTAGAACTTTTGCAGCTTCCATGCCCATGTACTGTGGCAGTAACTTACCCACAGTGTCTAAAAGAAGAGAGTCACGGAAAAGGAAATCCTGCAGGGACACGCGCGGAATTTGCCTGATGCTTTATTAAAAGTTGAATCCATGGGGCC
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGCTTCGTTTCTGAGCTGGTAAAGTCGCTGCTTTCCTAGACACATCTGGCGCAGCTTTCTTCTCAGGTGCTTTTCTCTTTTGAGGAGATTTGAGATTATCTGAAGCTTTTGCTGTAGAGGCTTGAAGGGCTTTTGTCTTTGGAGTTTTGTATTTGCCCTTCTGGGAGTACAGCAGGTTTCTCTGAAAGAGCAGGGGGATGTTGCCTTGATACAGAAAGAGGGCCAGCACCATGCCAGTCAAAGGGCCACAGCAATACACCAGTGAATATTCTGTCAGGGTGTTCCCAGAGCATTGGAAGGTCAGTGCGGCCGCCAGAGTGGGGTTAAAGAAAGCTCCAGTGTACGATCCAGCGGTGTAAGACAGGAGAGACACAGTAAGTGCAACTATAGGAACCCTGTAGATCAGCCTTGTGCTCTTGAAGCGAAGGATCACCAAATGGAAGCAGAGAGCGCACAATCCTTCAACAAAGACGCCATGAGCAACGGAGGTTTGCAGAGACGAGCTGCAGTCCTGAGCCATCAGATTCTGAATCATGTGGAATTCTGTGAGCTCCAATGCCCAGTATTGTTTCGTTAGAACTTTTGCAGCTTCCATGCCCATGTACTGTGGCAGTAACTTACCCACAGTGTCTAAAAGAAGAGAGTCACGGAAAAGGAAATCCTGCAGGGACACGCGCGGAATTTGCCTGATGCTTTATTAAAAGTTGAATCCATGGGGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGCTTCGTTTCTGAGCTGGT