ORFeome > aqp8 ORF1 – XORFeome v1.0

aqp8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aqp8
Gene ID: 6255301
Gene Page ID: 481925
ORF Xenbase ID: 17264637

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099368
Original XGC clone length: 789

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ840100
dbEST ID: 79657802
Trimmed Sequence: ATGGCCACATTTGCTAAATATGTCTCCGAGACAGAGCTGCAGAACATGGGTTCAGAATCCCAGGAAGGACTTACTGCTTTGGAGGAAGAGGAGCCTACAGTGCTGGAGAAGTACGTCCAACCCTGTGTAGCAGAACTTCTAGGAAGCACCTTCTTCATCTTCTCGGGTTGTCTTTCTGTGCTTGTAAACCCTCACAATGCTGGCCCACTCCTCCCTGCTCTGGTTCATGGATTCACACTGGCATCAGTCATCTCTGTCCTTGGCAATGTAAGTGGAGGACATTTCAACCCTGCAGTGACTCTGTCTGTTGTTATTTGTGGTGGCCTGACTCCTATCTTGCTGGTGCCCTACTGGGTTTGTCAGTTATCTGGTGGAATGCTGGGCGCTCTCCTGGCAAAGGGCCTGGCAGATCAAGAGTCATTCATCAATCACACCGGAGCGGCCTGCATGATAGATAGTGGGGATTTAATGGCCAGAGCGGTTGGTGTAGAAATTGTCTTCAGCTTTCTCCTGATTTTCACTGTGGTGATGGGAGCAGTGGGTGAGCTCAGCAAGACTCCACTTGCCCCTTACTCAATTGCCTTTGTTCTTACTGCCGGAATATTATCTGGAGGCAATATATCTGGGGTCCTGTCTGAATCCAGCACGAGCGTTGGGTCCTGCAGTGGTTGCTATTTATTGGGATTACCATTGGGTATACTGGGGTTGGCCCTCTGGCTGGGGGCTCTTTTTGGTTTCTCCGCCATTCAGGGTTTATTCTTGGCCGGA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCACATTTGCTAAATATGTCTCCGAGACAGAGCTGCAGAACATGGGTTCAGAATCCCAGGAAGGACTTACTGCTTTGGAGGAAGAGGAGCCTACAGTGCTGGAGAAGTACGTCCAACCCTGTGTAGCAGAACTTCTAGGAAGCACCTTCTTCATCTTCTCGGGTTGTCTTTCTGTGCTTGTAAACCCTCACAATGCTGGCCCACTCCTCCCTGCTCTGGTTCATGGATTCACACTGGCATCAGTCATCTCTGTCCTTGGCAATGTAAGTGGAGGACATTTCAACCCTGCAGTGACTCTGTCTGTTGTTATTTGTGGTGGCCTGACTCCTATCTTGCTGGTGCCCTACTGGGTTTGTCAGTTATCTGGTGGAATGCTGGGCGCTCTCCTGGCAAAGGGCCTGGCAGATCAAGAGTCATTCATCAATCACACCGGAGCGGCCTGCATGATAGATAGTGGGGATTTAATGGCCAGAGCGGTTGGTGTAGAAATTGTCTTCAGCTTTCTCCTGATTTTCACTGTGGTGATGGGAGCAGTGGGTGAGCTCAGCAAGACTCCACTTGCCCCTTACTCAATTGCCTTTGTTCTTACTGCCGGAATATTATCTGGAGGCAATATATCTGGGGTCCTGTCTGAATCCAGCACGAGCGTTGGGTCCTGCAGTGGTTGCTATTTATTGGGATTACCATTGGGTATACTGGGGTTGGCCCTCTGGCTGGGGGCTCTTTTTGGTTTCTCCGCCATTCAGGGTTTATTCTTGGCCGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACATTTGCTAAATATGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ840099
dbEST ID: 79657801
Trimmed Sequence: CTTTAGGAACAACCTATGGGATCTTCCTGCCAGAATAAACCTGTATAGCAGAGAAACCAAAAGAGCCCCAGCCAGAGGGCCAACCCAGTATACCCAATGGTAATCCCAATAATTAGCAACCACTGCAGGACCCAACGCTCGTGCTGGATTCAGACAGGACCCAGATATATTGCCTCCAGATAATATTCCGGCAGTAAGAACAAAGGCAATTGAGTAAGGGGCAAGTGGAGTCTTGCTGAGCTCACCCACTGCTCCCATCACCACAGTGAAAATCAGGAGAAAGCTGAAGACAATTTCTACACCAACCGCTCTGGCCATTAAATCCCCACTATCTATCATGCAGGCCGCTCCGGTGTGATTGATGAATGACTCTTGATCTGCCAGGCCCTTTGCCAGGAGAGCGCCCAGCATTCCACCAGATAACTGACAAACCCAGTAGGGCACCAGCAAGATAGGAGTCAGGCCACCACAAATAACAACAGACAGAGTCACTGCAGGGTTGAAATGTCCTCCACTTACATTGCCAAGGACAGAGATGACTGAGGCCAGTGTGAATCCGTGAACCAGAGCAGGGAGGAGTGGGCCAGCATTGTGAGGGTTTACAAGCACAGAAAGACAACCCCAAAAAATGAAAAAAGTGGCTTCTTAAAATTTTCTGCTCCCCAGGGTTTGGACTTACTTTCTCCAGCACTGTAAGGCTCCTCCTTCCTC
Full Trace Sequence: GGCGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTAGGAACAACCTATGGGATCTTCCTGCCAGAATAAACCTGTATAGCAGAGAAACCAAAAGAGCCCCAGCCAGAGGGCCAACCCAGTATACCCAATGGTAATCCCAATAATTAGCAACCACTGCAGGACCCAACGCTCGTGCTGGATTCAGACAGGACCCAGATATATTGCCTCCAGATAATATTCCGGCAGTAAGAACAAAGGCAATTGAGTAAGGGGCAAGTGGAGTCTTGCTGAGCTCACCCACTGCTCCCATCACCACAGTGAAAATCAGGAGAAAGCTGAAGACAATTTCTACACCAACCGCTCTGGCCATTAAATCCCCACTATCTATCATGCAGGCCGCTCCGGTGTGATTGATGAATGACTCTTGATCTGCCAGGCCCTTTGCCAGGAGAGCGCCCAGCATTCCACCAGATAACTGACAAACCCAGTAGGGCACCAGCAAGATAGGAGTCAGGCCACCACAAATAACAACAGACAGAGTCACTGCAGGGTTGAAATGTCCTCCACTTACATTGCCAAGGACAGAGATGACTGAGGCCAGTGTGAATCCGTGAACCAGAGCAGGGAGGAGTGGGCCAGCATTGTGAGGGTTTACAAGCACAGAAAGACAACCCCAAAAAATGAAAAAAGTGGCTTCTTAAAATTTTCTGCTCCCCAGGGTTTGGACTTACTTTCTCCAGCACTGTAAGGCTCCTCCTTCCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTAGGAACAACCTATGGGA