ORFeome > arf-1 ORF1 – XORFeome v1.0

arf-1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6492380
Gene Page ID:
ORF Xenbase ID: 17264667

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130156
Original XGC clone length: 546

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ838520
dbEST ID: 79656222
Trimmed Sequence: ATGGGGAATATCTTTGCAAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATTCTCATGGTGGGCCTGGATGCTGCAGGGAAGACAACAATTCTATACAAACTGAAGCTGGGCGAAATTGTGACCACCATTCCCACCATTGGTTTCAATGTGGAGACTGTTGAATACAAGAATATCAGCTTCACCGTGTGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTGTGGCGCCACTACTTCCAGAACACCCAAGGCTTGATCTTCGTAGTGGACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAAGAGCTCATGAGGATGCTAGCTGAAGATGAGCTCCGAGATGCTGTTCTCTTGGTGTTTGCCAACAAGCAGGACCTCCCCAATGCCATGAATGCGGCCGAAATCACAGACAAGCTGGGGCTGCACTCTCTACGCCACAGGAACTGGTACATTCACGCCACCTGTGCCACCAACGGGGAAGGGCTCTATGAAGGACTAGATTGGCTGTCTAATCAGCTCCGGAACCAGAAGTT
Full Trace Sequence: GCTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAATATCTTTGCAAACCTCTTCAAGGGCCTTTTTGGCAAAAAAGAAATGCGCATTCTCATGGTGGGCCTGGATGCTGCAGGGAAGACAACAATTCTATACAAACTGAAGCTGGGCGAAATTGTGACCACCATTCCCACCATTGGTTTCAATGTGGAGACTGTTGAATACAAGAATATCAGCTTCACCGTGTGGGATGTGGGCGGCCAGGACAAGATCCGGCCGCTGTGGCGCCACTACTTCCAGAACACCCAAGGCTTGATCTTCGTAGTGGACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAAGAGCTCATGAGGATGCTAGCTGAAGATGAGCTCCGAGATGCTGTTCTCTTGGTGTTTGCCAACAAGCAGGACCTCCCCAATGCCATGAATGCGGCCGAAATCACAGACAAGCTGGGGCTGCACTCTCTACGCCACAGGAACTGGTACATTCACGCCACCTGTGCCACCAACGGGGAAGGGCTCTATGAAGGACTAGATTGGCTGTCTAATCAGCTCCGGAACCAGAAGTTGCCAACTTTCCTTGTAAAAGTTGGCATTATAAGAAAACATTGCTTATCAGTTTTGTTGCACGAACAGGTCACTTATAATTCAAAATAAAAATCATTAATTTTCCATCCAACTGATATCACCTAAAACTGAGTCGTAATAACATGGGCTTAGCGTGATAAAAAAAAAAAAAAAAGAAAAAAAACAAAAAATCTCCACAATCTCAAAAACAAGGCCCGCAAAAGTATNATCGTTCTCTTTCCTCCTCTTCGAACAGTGTGTGGGTGAGGTGAGGTGTATTTTATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAATATCTTTGCAAACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838519
dbEST ID: 79656221
Trimmed Sequence: CTTCTGGTTCCGGAGCTGATTAGACAGCCAATCTAGTCCTTCATAGAGCCCGTCCCCGCTGGTGGCACAGGTGGCCTGAATGTACCAGTTCCTGTGGCGTAGAGAGTGCAGCCCCAGCTTGTCTGTGATTTCGGCCGCATTCATGGCATTGGGGAGGTCCTGCTTGTTGGCAAACACCAAGAGAACAGCATCTCGGAGCTCATCTTCAGCTAGCATCCTCATGAGCTCTTCACGGGCCTCGTTCACACGCTCTCTGTCATTGCTGTCCACTACGAAGATCAAGCCTTGGGTGTTCTGGAAGTAGTGGCGCCACAGCGGCCGGATCTTGTCCTGGCCGCCCACATCCCACACGGTGAAGCTGATATTCTTGTATTCAACAGTCTCCACATTGAAACCAATGGTGGGAATGGTGGTCACAATTTCGCCCAGCTTCAGTTTGTATAGAATTGTTGTCTTCCCTGCAGCATCCAGGCCCACCGTGAGAATGCGCATTTCTTTTTTGCCAAAAAGGCCCTTTAAGAGGTTTGCAGAGATATTTCCCATGG
Full Trace Sequence: GAGCAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTGGTTCCGGAGCTGATTAGACAGCCAATCTAGTCCTTCATAGAGCCCGTCCCCGCTGGTGGCACAGGTGGCCTGAATGTACCAGTTCCTGTGGCGTAGAGAGTGCAGCCCCAGCTTGTCTGTGATTTCGGCCGCATTCATGGCATTGGGGAGGTCCTGCTTGTTGGCAAACACCAAGAGAACAGCATCTCGGAGCTCATCTTCAGCTAGCATCCTCATGAGCTCTTCACGGGCCTCGTTCACACGCTCTCTGTCATTGCTGTCCACTACGAAGATCAAGCCTTGGGTGTTCTGGAAGTAGTGGCGCCACAGCGGCCGGATCTTGTCCTGGCCGCCCACATCCCACACGGTGAAGCTGATATTCTTGTATTCAACAGTCTCCACATTGAAACCAATGGTGGGAATGGTGGTCACAATTTCGCCCAGCTTCAGTTTGTATAGAATTGTTGTCTTCCCTGCAGCATCCAGGCCCACCGTGAGAATGCGCATTTCTTTTTTGCCAAAAAGGCCCTTTAAGAGGTTTGCAGAGATATTTCCCATGGTGCCAACTTTTTTGTACAAAGGTGGCATTTATAAAAAACAATTGCTCCTCAATTTGTTGCAGGGGACAGGTCACTATGGGGTCAAATTAAATCATAAAAAAGAAAACAAACAAATAAGAATGGCCCGCCCTTTTTGCACGCTCCATAAACAGGAAAAGGGGAGGTGGGTNNCCGGGAGGGGGGGGGGGGTGGGGGTGAAGAGGATGAAAGAAGAGAGGAGGNAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTGGTTCCGGAGCTGATT