ORFeome > arf6 ORF1 – XORFeome v1.0

arf6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arf6
Gene ID: 6078840
Gene Page ID: 5743883
ORF Xenbase ID: 17264691

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044124
Original XGC clone length: 528

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11009
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ823762
dbEST ID: 79641464
Trimmed Sequence: ATGGGTAAAATGCTATCCAAGGTGTTTGGGAATAAGGAGATGCGAATTTTGATGTTGGGTTTGGATGCTGCTGGGAAGACCACCATTCTTTACAAACTCAAGCTAGGACAGTCCGTCACCACTATCCCAACTGTAGGTTTCAATGTAGAAACGGTTACCTACAAAAATGTAAAATTTAATGTCTGGGATGTAGGCGGCCAGGACAAAATTCGGCCTCTCTGGCGGCATTACTATACTGGAACGCAGGGTCTCATCTTTGTCATCGATTGCGCTGATCGAGATCGGATCGACGAGGCACGTCAAGAACTCCACCGAATTATTAATGACCGAGAGATGCGAGATGCCATCATTCTCATCTTTGCCAATAAACAGGACCTTCCAGATGCCATGAAACCTCATGAGATCCAGGAAAAGCTTGGACTTACCCGCATTAGGGATAGAAACTGGTATGTCCAACCATCTTGTGCAAATACTGGAGAGGGACTTTGTGAAGGTCTCATGTGGTTGACATCGAATTACAAATCCTT
Full Trace Sequence: CCAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTAAAATGCTATCCAAGGTGTTTGGGAATAAGGAGATGCGAATTTTGATGTTGGGTTTGGATGCTGCTGGGAAGACCACCATTCTTTACAAACTCAAGCTAGGACAGTCCGTCACCACTATCCCAACTGTAGGTTTCAATGTAGAAACGGTTACCTACAAAAATGTAAAATTTAATGTCTGGGATGTAGGCGGCCAGGACAAAATTCGGCCTCTCTGGCGGCATTACTATACTGGAACGCAGGGTCTCATCTTTGTCATCGATTGCGCTGATCGAGATCGGATCGACGAGGCACGTCAAGAACTCCACCGAATTATTAATGACCGAGAGATGCGAGATGCCATCATTCTCATCTTTGCCAATAAACAGGACCTTCCAGATGCCATGAAACCTCATGAGATCCAGGAAAAGCTTGGACTTACCCGCATTAGGGATAGAAACTGGTATGTCCAACCATCTTGTGCAAATACTGGAGAGGGACTTTGTGAAGGTCTCATGTGGTTGACATCGAATTACAAATCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCGTGCTCAAAAAACAAAAATTAAAATAAAAAAANTGGGAGTANCCTTCTTTGGCGGCCCCCGGGGGGTGGGTTCCCTTGGTTTTTCCTTTTTCTTCGTCCCCCGCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTAAAATGCTATCCAAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829071
dbEST ID: 79646773
Trimmed Sequence: GGATTTGTAATTCGATGTCAACCACATGAGACCTTCACAAAGTCCCTCTCCAGTATTTGCACAAGATGGTTGGACATACCAGTTTCTATCCCTAATGCGGGTAAGTCCAAGCTTTTCCTGGATCTCATGAGGTTTCATGGCATCTGGAAGGTCCTGTTTATTGGCAAAGATGAGAATGATGGCATCTCGCATCTCTCGGTCATTAATAATTCGGTGGAGTTCTTGACGTGCCTCGTCGATCCGATCTCGATCAGCGCAATCGATGACAAAGATGAGACCCTGCGTTCCAGTATAGTAATGCCGCCAGAGAGGCCGAATTTTGTCCTGGCCGCCTACATCCCAGACATTAAATTTTACATTTTTGTAGGTAACCGTTTCTACATTGAAACCTACAGTTGGGATAGTGGTGACGGACTGTCCTAGCTTGAGTTTGTAAAGAATGGTGGTCTTCCCAGCAGCATCCAAACCCAACATCAAAATTCGCATCTCCTTATTCCCAAACACCTTGGATAGCATTTTACACATGG
Full Trace Sequence: GCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATTTGTAATTCGATGTCAACCACATGAGACCTTCACAAAGTCCCTCTCCAGTATTTGCACAAGATGGTTGGACATACCAGTTTCTATCCCTAATGCGGGTAAGTCCAAGCTTTTCCTGGATCTCATGAGGTTTCATGGCATCTGGAAGGTCCTGTTTATTGGCAAAGATGAGAATGATGGCATCTCGCATCTCTCGGTCATTAATAATTCGGTGGAGTTCTTGACGTGCCTCGTCGATCCGATCTCGATCAGCGCAATCGATGACAAAGATGAGACCCTGCGTTCCAGTATAGTAATGCCGCCAGAGAGGCCGAATTTTGTCCTGGCCGCCTACATCCCAGACATTAAATTTTACATTTTTGTAGGTAACCGTTTCTACATTGAAACCTACAGTTGGGATAGTGGTGACGGACTGTCCTAGCTTGAGTTTGTAAAGAATGGTGGTCTTCCCAGCAGCATCCAAACCCAACATCAAAATTCGCATCTCCTTATTCCCAAACACCTTGGATAGCATTTTACACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAAAAGGTCACTATCAGTCAAAATAAAATCATTATTTTGAAGCCCGAGCATAAAGACTGGCCGTCGTTTCAAGCTTGCGGGGAGGACGGGGGAATTCCCNAGGCCACCTTTGGGCCAAGTAATTCCCAAAGGGCGTTTTGTTCTTCCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTTGTAATTCGATGTCAACCA