ORFeome > arfrp1 ORF1 – XORFeome v1.0

arfrp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: arfrp1
Gene ID: 6251264
Gene Page ID: 6251244
ORF Xenbase ID: 17264727

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054219
Original XGC clone length: 606

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ839252
dbEST ID: 79656954
Trimmed Sequence: ATGTACACCCTGCTGTCTGGCCTGTATAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTCATCCTGGGCCTCGACAATGCTGGCAAAACGACCTTTCTGGAACAGACAAAAATCCAGTTCAGCCGTAACTACAAGGGAATGAACCTGTCCAAGATCACAACCACAGTTGGGCTAAACATTGGTACCATTGATGTTGGGAAGGTGCGGCTGATGTTCTGGGACCTGGGGGGGCAGGAGGAGCTGCAGTCACTGTGGGATAAGTATTATGCAGAGTCCCATGGGGTGATCTACGTTATTGATTCCACAGATGAAACACGCCTCTCAGAATCTAAGCACGCCTTTGAGCGGATGATCAGCAGCGAATCCTTGGAAGGAGTTCCCATCCTGGTTCTGGCTAACAAGCAGGATGTGGAGGGCTGTCTCTCCATTCCCGATGTAAAGACTGCCTTCAGTGATTGCATTAACAAGATTGGTAAGAGGGACTGCCTGACCCAGGCCTGCTCAGCGCTCTCGGGGACAGGGCTTAATGAGGGGGTGGAATGGATGGTTAAATGTGTCGTGAGGAATATTCACCGCCCCCCGCGGCAAAAAGACATCACATT
Full Trace Sequence: GCTCGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACACCCTGCTGTCTGGCCTGTATAAGTACATGTTTCAGAAGGACGAGTACTGCATCCTCATCCTGGGCCTCGACAATGCTGGCAAAACGACCTTTCTGGAACAGACAAAAATCCAGTTCAGCCGTAACTACAAGGGAATGAACCTGTCCAAGATCACAACCACAGTTGGGCTAAACATTGGTACCATTGATGTTGGGAAGGTGCGGCTGATGTTCTGGGACCTGGGGGGGCAGGAGGAGCTGCAGTCACTGTGGGATAAGTATTATGCAGAGTCCCATGGGGTGATCTACGTTATTGATTCCACAGATGAAACACGCCTCTCAGAATCTAAGCACGCCTTTGAGCGGATGATCAGCAGCGAATCCTTGGAAGGAGTTCCCATCCTGGTTCTGGCTAACAAGCAGGATGTGGAGGGCTGTCTCTCCATTCCCGATGTAAAGACTGCCTTCAGTGATTGCATTAACAAGATTGGTAAGAGGGACTGCCTGACCCAGGCCTGCTCAGCGCTCTCGGGGACAGGGCTTAATGAGGGGGTGGAATGGATGGTTAAATGTGTCGTGAGGAATATTCACCGCCCCCCGCGGCAAAAAGACATCACATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACAAACAGGTCACTATCATTCAAAATAAAATCATTATTTGCCATCCACCTGAAAACCCCTAAAATGGAATCTTATTACCCTAAAAAAAAAATTAATACCTGGAAAACTCTTGCCCCGGGTTTCAAAAATCCCCCAGAAAAATTAAAAAAAGCACTNTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACACCCTGCTGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839251
dbEST ID: 79656953
Trimmed Sequence: TGTGATGTCTTTCTGCCGCGGGGGGCGGTGAATATTCCTCACGACACATTTAACCATCCATTCCACCCCCTCATTAAGCCCTGTCCCCGAGAGCGCTGAGCAGGCCTGGGTCAGGCAGTCCCTCTTACCAATCTTGTTAATGCAATCACTGAAGGCAGTCTTTACATCGGGAATGGAGAGACAGCCCTCCACATCCTGCTTGTTAGCCAGAACCAGGATGGGAACTCCTTCCAAGGATTCGCTGCTGATCATCCGCTCAAAGGCGTGCTTAGATTCTGAGAGGCGTGTTTCATCTGTGGAATCAATAACGTAGATCACCCCATGGGACTCTGCATAATACTTATCCCACAGTGACTGCAGCTCCTCCTGCCCCCCCAGGTCCCAGAACATCAGCCGCACCTTCCCAACATCAATGGTACCAATGTTTAGCCCAACTGTGGTTGTGATCTTGGACAGGTTCATTCCCTTGTAGTTACGGCTGAACTGGATTTTTGTCTGTTCCAGAAAGGTCGTTTTGCCAGCATTGTCGAGGCCCAGGATGAGGATGCAGTACTCGTCCTTCTAAAACATGGACTTATACCGGCCAAACAGCAGGGTGTACATGGTGGC
Full Trace Sequence: GGGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTGATGTCTTTCTGCCGCGGGGGGCGGTGAATATTCCTCACGACACATTTAACCATCCATTCCACCCCCTCATTAAGCCCTGTCCCCGAGAGCGCTGAGCAGGCCTGGGTCAGGCAGTCCCTCTTACCAATCTTGTTAATGCAATCACTGAAGGCAGTCTTTACATCGGGAATGGAGAGACAGCCCTCCACATCCTGCTTGTTAGCCAGAACCAGGATGGGAACTCCTTCCAAGGATTCGCTGCTGATCATCCGCTCAAAGGCGTGCTTAGATTCTGAGAGGCGTGTTTCATCTGTGGAATCAATAACGTAGATCACCCCATGGGACTCTGCATAATACTTATCCCACAGTGACTGCAGCTCCTCCTGCCCCCCCAGGTCCCAGAACATCAGCCGCACCTTCCCAACATCAATGGTACCAATGTTTAGCCCAACTGTGGTTGTGATCTTGGACAGGTTCATTCCCTTGTAGTTACGGCTGAACTGGATTTTTGTCTGTTCCAGAAAGGTCGTTTTGCCAGCATTGTCGAGGCCCAGGATGAGGATGCAGTACTCGTCCTTCTAAAACATGGACTTATACCGGCCAAACAGCAGGGTGTACATGGTGGCCACCTTTTTTGTACAAGGTTGGCATTAAAAAAAAACATTGCCTCATCAATTTGTTGGCACCAAAAAGGGTCCCTATAAGTCCAAAAAAAAAGCAAAAAAAAGGAGGGCCCAAGCCTTAAGAAAGGGCGGTCGTTTTAAACACCCCCCGTCTTTGGCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTGATGTCTTTCTGCCG