ORFeome > arg1 ORF1 – XORFeome v1.0

arg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arg1
Gene ID: 6254072
Gene Page ID: 966912
ORF Xenbase ID: 17264733

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043635
Original XGC clone length: 972

Human orthology & disease relationships

NCBI Entrez ID: 383
Ensembl gene IDs: ENSG00000118520
Directly associated (OMIM) disease MIM numbers: 207800
Indirectly associated (Lage, et al.) disease MIM numbers: 123320,146800,192600,194050,207800,207900,215700,238970,259900,266140,311250,600794,601419,601472,604765,606072,606664,607801,608758,609924

Library Location

Plate ID: GDExl11010
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ823819
dbEST ID: 79641521
Trimmed Sequence: ATGAGTAGCCAAGGAAAGACATCAGTTGGAGTCATTGGAGCCCCATTCTCCAAGGGACAGCCAAGAAGAGGAGTGGAAGAGGGGCCTAAATATTTAAGAGAGGCCGGGTTAATTGAGAAATTAAGAGAATTTGGCAATGATGTTCGAGATTGTGGGGATTTGGATTTTCCTGATGTGCCTAATGACACACCATTTAACAATGTGAAAAACCCACGTACAGTTGGGAAAGCTACAGAAATATTGGCCAATGCTGTCACAGCAGTAAAGAAAGCTGACAAGACATGCCTAACCATTGGGGGAGATCACAGCTTGGCAGTGGGAACGATTGCCGGTCACGCAGCAGTTCACCCTAATCTCTGTGTTGTGTGGGTGGATGCCCATGCAGATATCAACACTCCGTCCACATCACCCAGTGGCAACCTTCATGGACAGCCGTTATCTTTTTTAATGAAAGAACTCAAAAGCAAGATGCCGGCTGTTCCAGGATTTGAGTGGGTGAAACCATGTCTCCGTAGCAAAGACATTGTATACATCGGCTTAAGAGATGTGGACCCAGGAGAGCATTACATTCTGAAGACACTTGGTATAAAATACTATTCAATGTCTGAAGTGGATTATCTTAAAATAGACAAAGTAATGGAAGAGACACTTGAATATTTGGTTGGCAAGCATAAGAGACCCATTCATTTAAGTTTTGACATTGATGGACTGGACCCAAGCATAGCCCCAGCTACTGGAACCCCTGTGGCCGGGAGGACTGACTTANCAGGGGAAGGGCATGTACATCACAAGAACAACTTTCCCCAAAACCGGGGTTTTATTTTCACCCAGG
Full Trace Sequence: AATGATTTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTAGCCAAGGAAAGACATCAGTTGGAGTCATTGGAGCCCCATTCTCCAAGGGACAGCCAAGAAGAGGAGTGGAAGAGGGGCCTAAATATTTAAGAGAGGCCGGGTTAATTGAGAAATTAAGAGAATTTGGCAATGATGTTCGAGATTGTGGGGATTTGGATTTTCCTGATGTGCCTAATGACACACCATTTAACAATGTGAAAAACCCACGTACAGTTGGGAAAGCTACAGAAATATTGGCCAATGCTGTCACAGCAGTAAAGAAAGCTGACAAGACATGCCTAACCATTGGGGGAGATCACAGCTTGGCAGTGGGAACGATTGCCGGTCACGCAGCAGTTCACCCTAATCTCTGTGTTGTGTGGGTGGATGCCCATGCAGATATCAACACTCCGTCCACATCACCCAGTGGCAACCTTCATGGACAGCCGTTATCTTTTTTAATGAAAGAACTCAAAAGCAAGATGCCGGCTGTTCCAGGATTTGAGTGGGTGAAACCATGTCTCCGTAGCAAAGACATTGTATACATCGGCTTAAGAGATGTGGACCCAGGAGAGCATTACATTCTGAAGACACTTGGTATAAAATACTATTCAATGTCTGAAGTGGATTATCTTAAAATAGACAAAGTAATGGAAGAGACACTTGAATATTTGGTTGGCAAGCATAAGAGACCCATTCATTTAAGTTTTGACATTGATGGACTGGACCCAAGCATAGCCCCAGCTACTGGAACCCCTGTGGCCGGGAGGACTGACTTANCAGGGGAAGGGCATGTACATCACAAGAACAACTTTCCCCAAAACCGGGGTTTTATTTTCACCCAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTAGCCAAGGAAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829127
dbEST ID: 79646829
Trimmed Sequence: GAAAATATCTGGAAGCATCATGGTCGATGCATGAAATCCTTCGCGTGCTTTCCCAAAGCATGACAAAGTCATATCAAGAGCAGTTTTAACTGTGACCTCAACGTCTCGCTTAGTTTCTCCGCGCGATGGGTTCACCTCCATAATGTCCACTGCTGAAAGTAAACCTGTTTTGTGAAGTTGTTCTGTGATGTACATGCCTTCCCTGTAAGTCAGTCCTCCAGGCACAGGGGTTCCAGTAGCTGGGGCTATGCTTGGGTCCAGTCCATCAATGTCAAAACTTAAATGAATGGGTCTCTTATGCTTGCCAACCAAATATTCAAGTGTCTCTTCCATTACTTTGTCTATTTTAAGATAATCCACTTCAGACATTGAATAGTATTTTATACCAAGTGTCTTCAGAATGTAATGCTCTCCTGGGTCCACATCTCTTAAGCCGATGTATACAATGTCTTTGCTACGGAGACATGGTTTCACCCACTCAAATCCTGGAACAGCCGGCATCTTGCTTTTGAGTTCTTTCATTAAAAAAGATAACGGCTGTCCATGAAGGTTGCCACTGGGTGATGTGGACGGAGTGTTGATATCTGCATGGGCATCCACCCACACAACACAGAGATTAGGGTGAACTGCTGCGTGACCGGCAATCGTTCCCACTGCCAAGCTGTGATCTCCCCCCATGGTTAGGCATGTCTTGTCAGCTTTTCTTACTGGCTGTGAACAGCATGGGCCAATAATTTCGGTAGCTTTTCCCAACGTGGAACCG
Full Trace Sequence: CGTGTAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAATATCTGGAAGCATCATGGTCGATGCATGAAATCCTTCGCGTGCTTTCCCAAAGCATGACAAAGTCATATCAAGAGCAGTTTTAACTGTGACCTCAACGTCTCGCTTAGTTTCTCCGCGCGATGGGTTCACCTCCATAATGTCCACTGCTGAAAGTAAACCTGTTTTGTGAAGTTGTTCTGTGATGTACATGCCTTCCCTGTAAGTCAGTCCTCCAGGCACAGGGGTTCCAGTAGCTGGGGCTATGCTTGGGTCCAGTCCATCAATGTCAAAACTTAAATGAATGGGTCTCTTATGCTTGCCAACCAAATATTCAAGTGTCTCTTCCATTACTTTGTCTATTTTAAGATAATCCACTTCAGACATTGAATAGTATTTTATACCAAGTGTCTTCAGAATGTAATGCTCTCCTGGGTCCACATCTCTTAAGCCGATGTATACAATGTCTTTGCTACGGAGACATGGTTTCACCCACTCAAATCCTGGAACAGCCGGCATCTTGCTTTTGAGTTCTTTCATTAAAAAAGATAACGGCTGTCCATGAAGGTTGCCACTGGGTGATGTGGACGGAGTGTTGATATCTGCATGGGCATCCACCCACACAACACAGAGATTAGGGTGAACTGCTGCGTGACCGGCAATCGTTCCCACTGCCAAGCTGTGATCTCCCCCCATGGTTAGGCATGTCTTGTCAGCTTTTCTTACTGGCTGTGAACAGCATGGGCCAATAATTTCGGTAGCTTTTCCCAACGTGGAACCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAATATCTGGAAGCATCATGGT