ORFeome > arl14ep ORF1 – XORFeome v1.0

arl14ep ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arl14ep
Gene ID: 6078812
Gene Page ID: 5726292
ORF Xenbase ID: 17264901

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097925
Original XGC clone length: 423

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: H05

Sequences - 5ʹ (forward) EST

Accession: JZ838414
dbEST ID: 79656116
Trimmed Sequence: ATGGCGGCGACGCGGGAGCAGAGCGCAGGCGGGAGTACACAGGGAGGGAAGAAGTACCAAGGGAAGGGGCGGGCTGCCAAAGCCTTGAAGTCCTTACAGTTTGCGAATCCTGGAAAACAAACAGAGTTTGCACCAGAGACAAGCAAAAGAGAAACGAGACGCCTGCAAACAAAAAGTGCTACCTCTAATTCAGGGCAGACAGCTGCTTCCAAGAATAAAGTGTACGACAGCAATGGGATTCTTATTTGCAACGGGAAGGATCTGTGCGACTGCCTGGATGAAGATTGTATGGGCTGCTTCTATTGCTGCAAAAAATGTGGCTCCAACAAGTGCGGCGTCGAATGTAGATGTGACCGAAAGTGGCTTTACGAACAGATTGAAATAGAAGGAGGCGAAACAATCCGCAATAAACACGTCAGTTT
Full Trace Sequence: TCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGACGCGGGAGCAGAGCGCAGGCGGGAGTACACAGGGAGGGAAGAAGTACCAAGGGAAGGGGCGGGCTGCCAAAGCCTTGAAGTCCTTACAGTTTGCGAATCCTGGAAAACAAACAGAGTTTGCACCAGAGACAAGCAAAAGAGAAACGAGACGCCTGCAAACAAAAAGTGCTACCTCTAATTCAGGGCAGACAGCTGCTTCCAAGAATAAAGTGTACGACAGCAATGGGATTCTTATTTGCAACGGGAAGGATCTGTGCGACTGCCTGGATGAAGATTGTATGGGCTGCTTCTATTGCTGCAAAAAATGTGGCTCCAACAAGTGCGGCGTCGAATGTAGATGTGACCGAAAGTGGCTTTACGAACAGATTGAAATAGAAGGAGGCGAAACAATCCGCAATAAACACGTCAGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGAAAAAAAAAAAAAAATCAAAAATGATACAAAACGGCAAATTTGGAACCCTCGGGGACAAAAGATCCCAACATCGTCCCCCCAAAAAAAAGAGGGGGCGGCTTCTTTCTTTTGTGTGGTGGGGAGGCGCCCCCCACGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCGACGCGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838413
dbEST ID: 79656115
Trimmed Sequence: ACTGACGTGTTTATTGCGGATTGTTTCGCCTCCTTCTATTTCAATCTGTTCGTAAAGCCACTTTCGGTCACATCTACATTCGACGCCGCACTTGTTGGAGCCACATTTTTTGCAGCAATAGAAGCAGCCCATACAATCTTCATCCAGGCAGTCGCACAGATCCTTCCCGTTGCAAATAAGAATCCCCTTGCTGTCGTACACTTTATTCTTGGAAGCAGCTGTCTGCCCTGAATTANAAGTAGCACTTTTTGTTTGCAGGCGTCTCGTTTCTCTTTTGCTTGTCTCTGGCGCAAACTCTGTTTGTTTTCCATGATTCGCAAACTGTAAGGACTTCAAGGCTTTGGCAGCCCGCCCCTTCCCTTGGTACTTCTTCCCTCCCTGTGTACTCCCGCCGGCGCTCTGCTCCCGCGTCGCCGCCATGG
Full Trace Sequence: AAGACGGCTATTGACCATGGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTGACGTGTTTATTGCGGATTGTTTCGCCTCCTTCTATTTCAATCTGTTCGTAAAGCCACTTTCGGTCACATCTACATTCGACGCCGCACTTGTTGGAGCCACATTTTTTGCAGCAATAGAAGCAGCCCATACAATCTTCATCCAGGCAGTCGCACAGATCCTTCCCGTTGCAAATAAGAATCCCCTTGCTGTCGTACACTTTATTCTTGGAAGCAGCTGTCTGCCCTGAATTANAAGTAGCACTTTTTGTTTGCAGGCGTCTCGTTTCTCTTTTGCTTGTCTCTGGCGCAAACTCTGTTTGTTTTCCATGATTCGCAAACTGTAAGGACTTCAAGGCTTTGGCAGCCCGCCCCTTCCCTTGGTACTTCTTCCCTCCCTGTGTACTCCCGCCGGCGCTCTGCTCCCGCGTCGCCGCCATGGTGCCAACGTTTTTTTAACGAATTTGNCATTATACCAAAGCATTGCTCATCAGTTTTTTGCAACAACAGGTCACTATCATTCGAGTTAAATCATTATTAGNNGNCAAAAAAAAAAAAAAAAAAAAATATTAATTTTCTTTCCCTGTTTGTGGGGCGCCGGGGAGAATATCCACATTTCGCCTCCCGAGGGGGGCGGGAAAAACATNTGGAGAAAAAAGAAGAGGCACACACACGGGAGAAAAAGACCGGTGGGGGAAGGGGGAGAGGAAAAAAGAAAGAAGGAACCCCGGGNGGGTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGACGTGTTTATTGCGGA