ORFeome > arpc2 ORF1 – XORFeome v1.0

arpc2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arpc2
Gene ID: 866076
Gene Page ID: 491570
ORF Xenbase ID: 17265063

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123262
Original XGC clone length: 903

Human orthology & disease relationships

NCBI Entrez ID: 10109
Ensembl gene IDs: ENSG00000163466
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 182290,215600,607841

Library Location

Plate ID: GDExl11091
Well Location: C07

Sequences - 5ʹ (forward) EST

Accession: JZ838817
dbEST ID: 79656519
Trimmed Sequence: ATGATCCTGCTGGAGGTCAATAACCGGATCATTGAGGAGATCCTCACCCTTAAATTTGAGAATGCGGCGGCCGGGAACAAGCCAGAGGCGGTGGAAGTGACTTTTGCAGATTTTGATGGTGTCCTGTATCATGTGTCCAACCCAAATGGAGACAAAGCGAAAGTCCTGATCAGTATTTCCCTCAAGTTCTACAAAGAGCTACAGGAGCATGGAACTGATGAGGTTTTAAAGAAGGTTTATGGAAATTTTCTTGTGGCCCCAGAGTCTGGTTACAATGTTTCTTTGCTTTATGACCTGGAGTCTCTGCCTTCCAACAAGGACTCCGTCATCCACCAGGCCGGCATGCTGAAGCGCAACTGCTTTGCCTCTGTTTTTGAGAAATACTTCAAGTTCCAGGAGGAGGGCAAGGACGGAGAGAAGAGAGCTGTGATCCACTATAGGGACGATGAAACCATGTACGTAGAAGCGAAGAAAGACCGGGTGACAGTTGTGTTCAGTACAGTCTTTAAAGATGATGATGATGTGGTAATCGGGAAGGTTTTCATGCAGGAGTTTAAGGAAGGGCGGCGTGCCCGTCCCACAGCTCCTCAGGTCCTCTTCAACCCCCGGAAGCGCCCCTTGAGCTCAAAATACTGATGCAGCAGTGGGGGACAACATTTGAAAATCACCTTTGTGCTCTTTCTCCTCCCACCAATGCCAATGCCGGAGAAAACACCATCCAATCTTACCCCCCAGTTCGGGGATTAGTTGGCACTGTCAAATCAGGGGGTTCCGAGG
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCCTGCTGGAGGTCAATAACCGGATCATTGAGGAGATCCTCACCCTTAAATTTGAGAATGCGGCGGCCGGGAACAAGCCAGAGGCGGTGGAAGTGACTTTTGCAGATTTTGATGGTGTCCTGTATCATGTGTCCAACCCAAATGGAGACAAAGCGAAAGTCCTGATCAGTATTTCCCTCAAGTTCTACAAAGAGCTACAGGAGCATGGAACTGATGAGGTTTTAAAGAAGGTTTATGGAAATTTTCTTGTGGCCCCAGAGTCTGGTTACAATGTTTCTTTGCTTTATGACCTGGAGTCTCTGCCTTCCAACAAGGACTCCGTCATCCACCAGGCCGGCATGCTGAAGCGCAACTGCTTTGCCTCTGTTTTTGAGAAATACTTCAAGTTCCAGGAGGAGGGCAAGGACGGAGAGAAGAGAGCTGTGATCCACTATAGGGACGATGAAACCATGTACGTAGAAGCGAAGAAAGACCGGGTGACAGTTGTGTTCAGTACAGTCTTTAAAGATGATGATGATGTGGTAATCGGGAAGGTTTTCATGCAGGAGTTTAAGGAAGGGCGGCGTGCCCGTCCCACAGCTCCTCAGGTCCTCTTCAACCCCCGGAAGCGCCCCTTGAGCTCAAAATACTGATGCAGCAGTGGGGGACAACATTTGAAAATCACCTTTGTGCTCTTTCTCCTCCCACCAATGCCAATGCCGGAGAAAACACCATCCAATCTTACCCCCCAGTTCGGGGATTAGTTGGCACTGTCAAATCAGGGGGTTCCGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCCTGCTGGAGGTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838816
dbEST ID: 79656518
Trimmed Sequence: GCGAGCGGCAAATGTTTTGCCCGTTATAGTTTTCATCTCTTTCTTCTCTGCGTCTGGACGGGCACGATTCAGAACTTTAAGGAAGTCAGATGTTTTCGCCCTCATGCGAGTGTGGATGTATGCCTTGGAACACTTGATGTGATAGTGCAAGTAATCACGGAATGTGTGGATAAGATTGATGGTGTTGTCTCGTGCATTGGCATTGGTGTGGCGAGGAAAGAGCACAAAGGTGATATATCCAATGTTGTCCCCCACTGCTGCATCAGTATCTTTGAGCTCAAGGGGTGGCTCCCGGTGGCTGAAGAGGACCTGAGGAGCTGTGTGACTGGCACGCCGCCCTTCCTTAAACTCCTGCATGAAAACCTTCCCGATTACCACATCATCATCATCTTTAAAGACTGTACTGAACACAACTGTCACCCGGTCCTTCTTCGCTTCTACGTACATGGTTTCATCGTCCCTATAGTGGATCACAGCTCTCTTCTCTCCGTCCTTGCCCTCCTCCTGGAACTTGAAGTATTTCTCAAAAACAGAAGCAAAGCAGTTGCGCTTCAGCATGCCGGCCTGGTGGATGACGGAGTCCTTGTTGGAAGGCAGAGACTCCCGGTCATAAAGCAAAAAACAATGTAACAAAACTCTGGGGCCACAAGAAGAATTTCCTAAAACTTTCTTTAAAAACCTCCTCAGCTACCCTCCTCCGTTTACTTCTTTTTTAAAAATTTGAAGGGAAAAAACGGAATTGGGGAAAATTTCCCCTTTGGCCCCC
Full Trace Sequence: AAAATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGAGCGGCAAATGTTTTGCCCGTTATAGTTTTCATCTCTTTCTTCTCTGCGTCTGGACGGGCACGATTCAGAACTTTAAGGAAGTCAGATGTTTTCGCCCTCATGCGAGTGTGGATGTATGCCTTGGAACACTTGATGTGATAGTGCAAGTAATCACGGAATGTGTGGATAAGATTGATGGTGTTGTCTCGTGCATTGGCATTGGTGTGGCGAGGAAAGAGCACAAAGGTGATATATCCAATGTTGTCCCCCACTGCTGCATCAGTATCTTTGAGCTCAAGGGGTGGCTCCCGGTGGCTGAAGAGGACCTGAGGAGCTGTGTGACTGGCACGCCGCCCTTCCTTAAACTCCTGCATGAAAACCTTCCCGATTACCACATCATCATCATCTTTAAAGACTGTACTGAACACAACTGTCACCCGGTCCTTCTTCGCTTCTACGTACATGGTTTCATCGTCCCTATAGTGGATCACAGCTCTCTTCTCTCCGTCCTTGCCCTCCTCCTGGAACTTGAAGTATTTCTCAAAAACAGAAGCAAAGCAGTTGCGCTTCAGCATGCCGGCCTGGTGGATGACGGAGTCCTTGTTGGAAGGCAGAGACTCCCGGTCATAAAGCAAAAAACAATGTAACAAAACTCTGGGGCCACAAGAAGAATTTCCTAAAACTTTCTTTAAAAACCTCCTCAGCTACCCTCCTCCGTTTACTTCTTTTTTAAAAATTTGAAGGGAAAAAACGGAATTGGGGAAAATTTCCCCTTTGGCCCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGAGCGGCAAATGTTTT