ORFeome > arsk ORF1 – XORFeome v1.0

arsk ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arsk
Gene ID: 1000372
Gene Page ID: 1000368
ORF Xenbase ID: 17265147

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123132
Original XGC clone length: 1611

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ838040
dbEST ID: 79655742
Trimmed Sequence: ATGATTCAAAAATGTATTGCCTTCTATCAGTGTACATCCTAACTGGGCGATGAGTGAGTTTCATGGATCCGATGCAAATGCTTCAACCTACATGCTTTGGGATAATTACTGGAAGTATGTTGCATATGCGGACGGTGATTCAGTTGCTCCACAGTTGTTTGATTTATCATCTGATCCAGATGAGCTAACAAATGTTGCAGGACAGGTTCCTGAGAAGGTTCAAGAGATGGATAAAAAGCTTCGTTCCATTGTTGACTATCCAAAAGTATCAGCCTCTGTACATGTATACAACAAGCAGCAGTTTGCACTGTGGAAGGCAAGTGTAGGGGCAAACTACACAAATGTCATAGCTAACCTCCGGTGGCACGCAGACTGGAACAAAAGACCAAGAGCATATGAAATGGCAATAGAGAAGTGGATTAAAAGCACACGCCAACATTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATTCAAAAATGTATTGCCTTCTATCAGTGTACATCCTAACTGGGCGATGAGTGAGTTTCATGGATCCGATGCAAATGCTTCAACCTACATGCTTTGGGATAATTACTGGAAGTATGTTGCATATGCGGACGGTGATTCAGTTGCTCCACAGTTGTTTGATTTATCATCTGATCCAGATGAGCTAACAAATGTTGCAGGACAGGTTCCTGAGAAGGTTCAAGAGATGGATAAAAAGCTTCGTTCCATTGTTGACTATCCAAAAGTATCAGCCTCTGTACATGTATACAACAAGCAGCAGTTTGCACTGTGGAAGGCAAGTGTAGGGGCAAACTACACAAATGTCATAGCTAACCTCCGGTGGCACGCAGACTGGAACAAAAGACCAAGAGCATATGAAATGGCAATAGAGAAGTGGATTAAAAGCACACGCCAACATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTAAAAAAAAAAATAAGAACCATGTAATAGAATCTTTTAATTTCACGGGACCAAAAAGAAAAAAAACCTCTCTCACCAACCGGGCCGGTGGTGTTTCCCTTTTGTTAGCCTGGAAGGGCTCCCCCGGAAGAAAAAAACAGAAAAAAACAAAATATATTATAAAATAAAAAAAAAACACGCGCGACCCGTGCGAACAACAAAAAAAAAAACAAAAAAAGGAAAAAAAAAACAAAGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCAAAAATGTATTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838039
dbEST ID: 79655741
Trimmed Sequence: ATGTTGGCGTGTGCTTTTAATCCACTTCTCTATTGCCATTTCATATGCTCTTGGTCTTTTGTTCCAGTCTGCGTGCCACCGGAGGTTAGCTATGACATTTGTGTAGTTTGCCCCTACACTTGCCTTCCACAGTGCAAACTGCTGCTTGTTGTATACATGTACAGAGGCTGATACTTTTGGATAGTCAACAATGGAACGAAGCTTTTTATCCATCTCTTGAACCTTCTCAGGAACCTGTCCTGCAACATTTGTTAGCTCATCTGGATCAGATGATAAATCAAACAACTGTGGAGCAACTGAATCACCGTCCGCATATGCAACATACTTCCAGTAATTATCCCAAAGCATGTAGGTTGAAGCATTTGCATCGGATCCATGAAACTCACTCATCGCCCAGTTAGGATGTACACTGATAGAAGGCAATACATTTTTGAATCATGG
Full Trace Sequence: GGAAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATGTTGGCGTGTGCTTTTAATCCACTTCTCTATTGCCATTTCATATGCTCTTGGTCTTTTGTTCCAGTCTGCGTGCCACCGGAGGTTAGCTATGACATTTGTGTAGTTTGCCCCTACACTTGCCTTCCACAGTGCAAACTGCTGCTTGTTGTATACATGTACAGAGGCTGATACTTTTGGATAGTCAACAATGGAACGAAGCTTTTTATCCATCTCTTGAACCTTCTCAGGAACCTGTCCTGCAACATTTGTTAGCTCATCTGGATCAGATGATAAATCAAACAACTGTGGAGCAACTGAATCACCGTCCGCATATGCAACATACTTCCAGTAATTATCCCAAAGCATGTAGGTTGAAGCATTTGCATCGGATCCATGAAACTCACTCATCGCCCAGTTAGGATGTACACTGATAGAAGGCAATACATTTTTGAATCATGGTGCCGACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAATAGAATCATTATTTTNNAAAAAAAAAAAAAAAATAAATATTCATCCTAAATTTTGGTAAACTGCGGGGCCAAAAAAACAAAAACTCTCTTTCCCCACAGGTGCCTGGCGGTCTCCCTTTTTGGTCCGGGGTGAAGCGAGCCCAAGAAAAAATACACGTTTCGGTCTTTTCCGCGTGTGGAAGTAGGTAGACGTGCGACGCCACAGGGCAAAAAACATACACAATAAACAACGGGGGTGGGGCGCCCGACGGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTTGGCGTGTGCTTTTAATC