ORFeome > art1 ORF1 – XORFeome v1.0

art1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: art1
Gene ID: 5767828
Gene Page ID: 5767812
ORF Xenbase ID: 17265153

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC153779
Original XGC clone length: 954

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ838998
dbEST ID: 79656700
Trimmed Sequence: ATGGGGGCTGGAAGCCCTGGTACCAACATCTTCTGGGCACTCGCTCTGATCTCCACCCTGTCACTCATCCACCCCAGCGAGGGTGACAGGACTCGAATGTACAGGAGAGACGCATTCCTATCAAAGGAGTCTGTGTTGGACATGGCACCCTCTTCTTATGATGATCAGTACAAAGGGTGCACTGAGGCCATGGAGGCCGAAATTCCTAAACTCTTTCAATACGAGTATTCCTCAAACAAGGACTTTGCTGAAGCCTGGGATTCTGCCACCTTCCAATGGGAAGAGAGAAAGGGAAAGATGGTGGTTCCCTCTGGATTTAAGGACCAGTATGCTATAGCAATATTTGCCTACACCAGCAATGGGCCTCTCCACAAAATCTTCAATGAGGCTGTGCGCCAGACTGGGCAGTCCAGAGAGTATTATTTAAGAAACTTCAATTTCAAGGTCCTACATTACTATCTGACCAGGGCACTTCAGATGTTGGATGCTGTGGAATCACCAACTTGCCACAAAGTCTTCAGAGGAATAAAGGGGGGTCCGGTTCAAATCAGAGCCCAGGAAACCAGTCCGTTTTGGCCAATTCACATCTTCATCAAAGGATGATCAGAGCGCTTTGTCCTTTGGAGAAGACACCTTCTTTAGCATCCATACCTGCTACGGGGTCAACATCAGGAACTTCTCTTTCTTCCCCCGGTGAGGAAGAAGTCCTTATCCCACCCTTTGAGAAATCAAAAGTCACCGATTTCAATACAGTGAACAGAAAAAACATCATCCACTCTCCAAATCCGTGGAAAAAAC
Full Trace Sequence: GGCCCCAAATAATAGATTTTTATTTATGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGGCTGGAAGCCCTGGTACCAACATCTTCTGGGCACTCGCTCTGATCTCCACCCTGTCACTCATCCACCCCAGCGAGGGTGACAGGACTCGAATGTACAGGAGAGACGCATTCCTATCAAAGGAGTCTGTGTTGGACATGGCACCCTCTTCTTATGATGATCAGTACAAAGGGTGCACTGAGGCCATGGAGGCCGAAATTCCTAAACTCTTTCAATACGAGTATTCCTCAAACAAGGACTTTGCTGAAGCCTGGGATTCTGCCACCTTCCAATGGGAAGAGAGAAAGGGAAAGATGGTGGTTCCCTCTGGATTTAAGGACCAGTATGCTATAGCAATATTTGCCTACACCAGCAATGGGCCTCTCCACAAAATCTTCAATGAGGCTGTGCGCCAGACTGGGCAGTCCAGAGAGTATTATTTAAGAAACTTCAATTTCAAGGTCCTACATTACTATCTGACCAGGGCACTTCAGATGTTGGATGCTGTGGAATCACCAACTTGCCACAAAGTCTTCAGAGGAATAAAGGGGGGTCCGGTTCAAATCAGAGCCCAGGAAACCAGTCCGTTTTGGCCAATTCACATCTTCATCAAAGGATGATCAGAGCGCTTTGTCCTTTGGAGAAGACACCTTCTTTAGCATCCATACCTGCTACGGGGTCAACATCAGGAACTTCTCTTTCTTCCCCCGGTGAGGAAGAAGTCCTTATCCCACCCTTTGAGAAATCAAAAGTCACCGATTTCAATACAGTGAACAGAAAAAACATCATCCACTCTCCAAATCCGTGGAAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGCTGGAAGCCCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838997
dbEST ID: 79656699
Trimmed Sequence: GGGTAAGAGCAGAGCCCCCAGAGGGTCCCATAGGAATATCAGCCAACAGATCGGAATAATCTTCAGAATTTCCACCCTGGGGCCTGTGGCTGAACTGAAAGGGCACCACGAGGCTTTGCATCTTCTCTCTTTCACAAACTCACAATTGTACACACTGGACTTTTCCACAGACTGGAGAGTGATGATGTTTTTTCTGCTCACTGTATTGAAATCGGTGACTTTGAATTTCTCAAAGGGTGGGATAAGGACTTCTTCCTCACCGGGGAAGAAAGAGAAGTTCCTGATGTTGACCCCGTAGCAGGTATGGATGCTAAAGAAGGTGTCTTCTCCAAAGGACAAAGCGCTCTGATCATCCTTTGATGAAGATGTGAATTGGCCAAAACGGACTGGTTTCCTGGGCTCTGATTTGAACCGGACCCCCTTTATTCCTCTGAAGACTTTGTGGCAAGTTGGTGATTCCACAGCATCCAACATCTGAAGTGCCCTGGTCAGATAGTAATGTAGGACCTTGAAATTGAAGTTTCTTAAATAATACTCTCTGGACTGCCCAGTCTGGCGCACAGCCTCATTGAAGATTTTGTGGAGAGGCCCATTGCTGGTGTAGGCAAATATTGCTATAACATACTGGTCCTTTAATCCGAAGGGAACCACCATCTTTTCCCTTTCTCTCTTCCCATTTGGAAGGGTGGCAGAAATCCCCAGGCTTCCACCCAAAGTTCCCTTGTTTTGAAGGGAAAACATTCGATAT
Full Trace Sequence: GGAAACGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGTAAGAGCAGAGCCCCCAGAGGGTCCCATAGGAATATCAGCCAACAGATCGGAATAATCTTCAGAATTTCCACCCTGGGGCCTGTGGCTGAACTGAAAGGGCACCACGAGGCTTTGCATCTTCTCTCTTTCACAAACTCACAATTGTACACACTGGACTTTTCCACAGACTGGAGAGTGATGATGTTTTTTCTGCTCACTGTATTGAAATCGGTGACTTTGAATTTCTCAAAGGGTGGGATAAGGACTTCTTCCTCACCGGGGAAGAAAGAGAAGTTCCTGATGTTGACCCCGTAGCAGGTATGGATGCTAAAGAAGGTGTCTTCTCCAAAGGACAAAGCGCTCTGATCATCCTTTGATGAAGATGTGAATTGGCCAAAACGGACTGGTTTCCTGGGCTCTGATTTGAACCGGACCCCCTTTATTCCTCTGAAGACTTTGTGGCAAGTTGGTGATTCCACAGCATCCAACATCTGAAGTGCCCTGGTCAGATAGTAATGTAGGACCTTGAAATTGAAGTTTCTTAAATAATACTCTCTGGACTGCCCAGTCTGGCGCACAGCCTCATTGAAGATTTTGTGGAGAGGCCCATTGCTGGTGTAGGCAAATATTGCTATAACATACTGGTCCTTTAATCCGAAGGGAACCACCATCTTTTCCCTTTCTCTCTTCCCATTTGGAAGGGTGGCAGAAATCCCCAGGCTTCCACCCAAAGTTCCCTTGTTTTGAAGGGAAAACATTCGATAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTAAGAGCAGAGCCCCCA