ORFeome > asb12 ORF1 – XORFeome v1.0

asb12 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: asb12
Gene ID: 5924802
Gene Page ID: 5924778
ORF Xenbase ID: 17265189

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078478
Original XGC clone length: 891

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ839808
dbEST ID: 79657510
Trimmed Sequence: ATGCTTCAGCTTAGAGGGCATGAATATGACCTTACAGAAAGCTGTCAGCTCCACCTTACAGTGGCAAAAGATGATCCTCATCAACTCAGCGAGCTACTGTCTCAATCCAGGTACAAGGAAGTTATCAACAGCCCTAGCGGCTGGGGCGTTCCAGAAACCCCTCTCCGTTGTGCTGCATCTCATGGCTTTTTAAACTGTCTGAAAATCCTGTTGGACAATGGAGCAGAGGTTGACAGGTTAGATGTGAAGGCCCAGACTCCACTTTTTACTGCTGTCAGTGCTGGCCATTTGGAGTGTGTTAAAGCATTACTGCAAGCTGGAGCTAATCCTTGTGGGAGCATGTACAATAACTGTTCCCCCATACTTACTGCAGCGCAGAATGGGAATGACAACATATTAACAGAGCTCTTAAAATATAGAGCTGAAGCCAATGTCAAGTCGAAACGGCCTGGCTGTGCTTTAGGTATTAAGACCTCCACTGGACCATTATACATTTCTGCTATATATGACCACTTACATTGTTTTAAGACTTTGCTTCTTCATGGTGCTGACCCAGATTACAACTGCACAGATCAGAAACTTCTACAAAGGATCAAGCGCCCCAGGCCTGTGCTGGAGATATGTCTAAAACACGGCCTGAGGGTGGACTTTGTGAAACTGCTTATTGAATTTGGGGCCAATGTTCACTTGTGGGAATAAAATGTTATTTAATTCAGTCCTGAATAATGAAGGCACCGGAACTCCTTGATCCAACAAAAAGGGGTCGTCCCAAAAACTTTTTATGGTCCTGAAATTGTCCTTTTGGACCCCTTAA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTCAGCTTAGAGGGCATGAATATGACCTTACAGAAAGCTGTCAGCTCCACCTTACAGTGGCAAAAGATGATCCTCATCAACTCAGCGAGCTACTGTCTCAATCCAGGTACAAGGAAGTTATCAACAGCCCTAGCGGCTGGGGCGTTCCAGAAACCCCTCTCCGTTGTGCTGCATCTCATGGCTTTTTAAACTGTCTGAAAATCCTGTTGGACAATGGAGCAGAGGTTGACAGGTTAGATGTGAAGGCCCAGACTCCACTTTTTACTGCTGTCAGTGCTGGCCATTTGGAGTGTGTTAAAGCATTACTGCAAGCTGGAGCTAATCCTTGTGGGAGCATGTACAATAACTGTTCCCCCATACTTACTGCAGCGCAGAATGGGAATGACAACATATTAACAGAGCTCTTAAAATATAGAGCTGAAGCCAATGTCAAGTCGAAACGGCCTGGCTGTGCTTTAGGTATTAAGACCTCCACTGGACCATTATACATTTCTGCTATATATGACCACTTACATTGTTTTAAGACTTTGCTTCTTCATGGTGCTGACCCAGATTACAACTGCACAGATCAGAAACTTCTACAAAGGATCAAGCGCCCCAGGCCTGTGCTGGAGATATGTCTAAAACACGGCCTGAGGGTGGACTTTGTGAAACTGCTTATTGAATTTGGGGCCAATGTTCACTTGTGGGAATAAAATGTTATTTAATTCAGTCCTGAATAATGAAGGCACCGGAACTCCTTGATCCAACAAAAAGGGGTCGTCCCAAAAACTTTTTATGGTCCTGAAATTGTCCTTTTGGACCCCTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTCAGCTTAGAGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839807
dbEST ID: 79657509
Trimmed Sequence: GGGTTCATACTGTAAATAGTTGATCAGTGCTTGGGGAATCTCCAGCTGGCCAATGAGATGTGTCTTTCTTATTCGCATTAGATGATTTCTTATGGTCAAACGACACTCAGACATTAAAGCTCTTGGACGACCCTTTTCTTGCATCAAGAGTTCCGCTGCCTCATTATTCAGGACTGATTTAATAACATCTTCATCCACCAAGTGAACATTGGCCCCAAATTCAATAAGCAGTTTCACAAAGTCCACCCTCAGGCCGTGTTTTAGACATATCTCCAGCACAGGCCTGGGGCGCTTGATCCTTTGTAGAAGTTTCTGATCTGTGCAGTTGTAATCTGGGTCAGCACCATGAAGAAGCAAAGTCTTAAAACAATGTAAGTGGTCATATATAGCAGAAATGTATAATGGTCCAGTGGAGGTCTTAATACCTAAAGCACAGCCAGGCCGTTTCGACTTGACATTGGCTTCAGCTCTATATTTTAAGAGCTCTGTTAATATGTTGTCATTCCCATTCTGCGCTGCAGTAAGTATGGGGGGAACAGTTATTGTACATGCTCCCACAAGGATTAGCTCCAGCTTGCAGTAATGCTTTAACACACTCCCAATGGCCAGCACTGACAGCAATAAAAAGTGGAGTCTGGGCCCTCACATCTAACCTGTCACCCTCTGCTCCATTGTCCAACAGGATTTTCAGACCATTTAAAAAACCATGAAATGCACCAAAAACGGGAAAAGGGGTTTCTGGAAAGGCCCCCACCCGCCCAGGGGGCGGTT
Full Trace Sequence: GAAAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGTTCATACTGTAAATAGTTGATCAGTGCTTGGGGAATCTCCAGCTGGCCAATGAGATGTGTCTTTCTTATTCGCATTAGATGATTTCTTATGGTCAAACGACACTCAGACATTAAAGCTCTTGGACGACCCTTTTCTTGCATCAAGAGTTCCGCTGCCTCATTATTCAGGACTGATTTAATAACATCTTCATCCACCAAGTGAACATTGGCCCCAAATTCAATAAGCAGTTTCACAAAGTCCACCCTCAGGCCGTGTTTTAGACATATCTCCAGCACAGGCCTGGGGCGCTTGATCCTTTGTAGAAGTTTCTGATCTGTGCAGTTGTAATCTGGGTCAGCACCATGAAGAAGCAAAGTCTTAAAACAATGTAAGTGGTCATATATAGCAGAAATGTATAATGGTCCAGTGGAGGTCTTAATACCTAAAGCACAGCCAGGCCGTTTCGACTTGACATTGGCTTCAGCTCTATATTTTAAGAGCTCTGTTAATATGTTGTCATTCCCATTCTGCGCTGCAGTAAGTATGGGGGGAACAGTTATTGTACATGCTCCCACAAGGATTAGCTCCAGCTTGCAGTAATGCTTTAACACACTCCCAATGGCCAGCACTGACAGCAATAAAAAGTGGAGTCTGGGCCCTCACATCTAACCTGTCACCCTCTGCTCCATTGTCCAACAGGATTTTCAGACCATTTAAAAAACCATGAAATGCACCAAAAACGGGAAAAGGGGTTTCTGGAAAGGCCCCCACCCGCCCAGGGGGCGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTTCATACTGTAAATAGTTGAT