ORFeome > asb13 ORF1 – XORFeome v1.0

asb13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: asb13
Gene ID: 5837705
Gene Page ID: 5837685
ORF Xenbase ID: 17265201

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124837
Original XGC clone length: 861

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ838304
dbEST ID: 79656006
Trimmed Sequence: ATGGAAACAGAGGCAGTGCCAATCATCGCCTCGGTGGCTCTTCGGGGCCCTCTCATCGGGGACATTGGAAATTGGCATTCTAGAACACCAGTACATGATGCTTCTAGACACGGCAATACTTCGCAGCTCAGAGAGCTGATTGACAGCGGGGTCTGTGTGAACCTGGTTACTGTGGATTCAATAACACCTCTTCATGAAGCTTGCCTACATGGACATATCCAGTGTGTGAAGTTGCTGCTAGCTGCTGGTGCTCAGGTGGATGCTAGAAATATTGATGGAAGCACTCCTCTGTGTGATGCCTCTGCAGCAGGTAGTCTGGAATGTGTGAAGTTTCTCTTAGACAATGGTGCCAAAGTGAACCCTCCACTTTTTACTGCTTCACCCCTCCATGAAGCTTGCATGAGTGGAAAATCAGAATGTGTAAAGTTATTGATAGAAGTAGGAGCAAACCTTGAAGCTCATGATTGCCACTTTGGAACACCCTTACATGTAGCGTGCGCCAGAGAGCATTTGGACTGTGCAAAGGCCTTACTTCATGCAGGAGCAAATGTGAATGCAGCAAAACTCCATGAAACTGCACTTCACCATGCAGCANAGGTGAAAAATACAGAGCTTGTCAAGATGTTAGTTTGATTTGGAGGAAATGTTTATGCCAGAGACAATAGGGGAAAAAAACCCACGGATTATACCTGGGCCAAACAGTCCTACTGCCCAATGTTTTGAATACTATGAAAAAGACACCCAGAAGCCTTTTATCACCTTCTGCAAGCTTAACCTCCAAAAAAACCTTTGGGGAAAAAAAACTGGGGGAAAAGAAATTCT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAACAGAGGCAGTGCCAATCATCGCCTCGGTGGCTCTTCGGGGCCCTCTCATCGGGGACATTGGAAATTGGCATTCTAGAACACCAGTACATGATGCTTCTAGACACGGCAATACTTCGCAGCTCAGAGAGCTGATTGACAGCGGGGTCTGTGTGAACCTGGTTACTGTGGATTCAATAACACCTCTTCATGAAGCTTGCCTACATGGACATATCCAGTGTGTGAAGTTGCTGCTAGCTGCTGGTGCTCAGGTGGATGCTAGAAATATTGATGGAAGCACTCCTCTGTGTGATGCCTCTGCAGCAGGTAGTCTGGAATGTGTGAAGTTTCTCTTAGACAATGGTGCCAAAGTGAACCCTCCACTTTTTACTGCTTCACCCCTCCATGAAGCTTGCATGAGTGGAAAATCAGAATGTGTAAAGTTATTGATAGAAGTAGGAGCAAACCTTGAAGCTCATGATTGCCACTTTGGAACACCCTTACATGTAGCGTGCGCCAGAGAGCATTTGGACTGTGCAAAGGCCTTACTTCATGCAGGAGCAAATGTGAATGCAGCAAAACTCCATGAAACTGCACTTCACCATGCAGCANAGGTGAAAAATACAGAGCTTGTCAAGATGTTAGTTTGATTTGGAGGAAATGTTTATGCCAGAGACAATAGGGGAAAAAAACCCACGGATTATACCTGGGCCAAACAGTCCTACTGCCCAATGTTTTGAATACTATGAAAAAGACACCCAGAAGCCTTTTATCACCTTCTGCAAGCTTAACCTCCAAAAAAACCTTTGGGGAAAAAAAACTGGGGGAAAAGAAATTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAACAGAGGCAGTGCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838303
dbEST ID: 79656005
Trimmed Sequence: ATTATATGTTAAATATTGCTTAAGTCTTGTGGGGATATTTAATTTGAGAATCTTTTCCACAGCTCTTTGCCCAAGTGTTTTTCTGAGGTTAAGCCTGCAGAGCTGATAAAGGCTCCTGGGTGTCTTTTCATAGTATTCAAAACATTTGGCAGTAGGACTGTTTGGCCAGGTATAATCCGTGGGTTTCTTTCCCCTATTGTCTCTGGCATAAACATTTCCTCCAAATTCAACTAACATCTTGACAAGCTCTGTATTTTTCACCTTTGCTGCATGGTGAAGTGCAGTTTCATGGAGTTTTGCTGCATTCACATTTGCTCCTGCATGAAGTAAGGCCTTTGCACAGTCCAAATGCTCTCTGGCGCACGCTACATGTAAGGGTGTTCCAAAGTGGCAATCATGAGCTTCAAGGTTTGCTCCTACTTCTATCAATAACTTTACACATTCTGATTTTCCACTCATGCAAGCTTCATGGAGGGGTGAAGCAGTAAAAAGTGAAGGGTTCACTTTTGCACCATTTTCTAAGAAAAACTTCACACATTCCCGAATACCCTGCTGCAGAGGCGTCACACAGAAAGAGTGGCTTCTATCAATATTTTCTAGCATCCAACCTCAACACCAGCCAGCTAGCAGCAACTTCCCACACTTGGAAATTGTCCATGTAGGCCAGCCTTCTGGAAAAAGTTTTAATTGAAATCAACAATAACCGAAGGTTCACACAAAAACCCGGCTTCCCGATTCACCTTCCTTTTACCCTTTGCCAAAATTATAGCACCTTTTTTCCTAA
Full Trace Sequence: GAGCAATATGCTAGTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTATATGTTAAATATTGCTTAAGTCTTGTGGGGATATTTAATTTGAGAATCTTTTCCACAGCTCTTTGCCCAAGTGTTTTTCTGAGGTTAAGCCTGCAGAGCTGATAAAGGCTCCTGGGTGTCTTTTCATAGTATTCAAAACATTTGGCAGTAGGACTGTTTGGCCAGGTATAATCCGTGGGTTTCTTTCCCCTATTGTCTCTGGCATAAACATTTCCTCCAAATTCAACTAACATCTTGACAAGCTCTGTATTTTTCACCTTTGCTGCATGGTGAAGTGCAGTTTCATGGAGTTTTGCTGCATTCACATTTGCTCCTGCATGAAGTAAGGCCTTTGCACAGTCCAAATGCTCTCTGGCGCACGCTACATGTAAGGGTGTTCCAAAGTGGCAATCATGAGCTTCAAGGTTTGCTCCTACTTCTATCAATAACTTTACACATTCTGATTTTCCACTCATGCAAGCTTCATGGAGGGGTGAAGCAGTAAAAAGTGAAGGGTTCACTTTTGCACCATTTTCTAAGAAAAACTTCACACATTCCCGAATACCCTGCTGCAGAGGCGTCACACAGAAAGAGTGGCTTCTATCAATATTTTCTAGCATCCAACCTCAACACCAGCCAGCTAGCAGCAACTTCCCACACTTGGAAATTGTCCATGTAGGCCAGCCTTCTGGAAAAAGTTTTAATTGAAATCAACAATAACCGAAGGTTCACACAAAAACCCGGCTTCCCGATTCACCTTCCTTTTACCCTTTGCCAAAATTATAGCACCTTTTTTCCTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTATATGTTAAATATTG